Rh5BG184800

Belongs to the cytochrome P450 family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Forward (+)
20318286 .. 20318807
522 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG184800.1

Sequence Viewer

Length: 522 bp
ATGGACATGACCACCAAGCAACAACTCAAGACACATTGGGAAGGAAAGAGCAAAGTACAAGTCTATCCTTTGTCCAAAATCTTCACCTTGGCTCTGGCTAGTAGATTCTTTCTGGGTATTGAGGACTATGACTGTGTGACTAAACTAGTCCAAGAGTTTGATGATGTGTCTTTGGGCCTCCATTGCATCCCTTTGAATTTTCCAGGAACTATTTTCAATAGGGCAAGTAAAGGAGCAGCTGCTATAAGGAAGCAGATCATATCCATCATCAAGGAGAAGAAAGCTGCTGCTTTGTTAAGTGGGAAGCCAGGGCGTGACATACTTTCTTACATGATTGCAAGTACTGATTCTTCAGGCAAGTTCATGCCTGAAACCGAGCTTGCTGATAAGGTCATGGGTTTGCTCACTGCTGGTTATAGCACAGTTGCTAGTGCTTTAACCTTTGTCATGAAATTTGTTGGAGAAAGACCAGATATCTACAACAAGATACTTGCAGGTACATATATGCATCTTCATGGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

173

Amino Acids

19.07

Weight (kDa)

9.17

Isoelectric Point (pI)

29.88

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
p450 PF00067 13 - 163 2.8e-10 Cytochrome P450
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 485
AcsI RAATTY 2 cut(s) 196, 452
AcuI CTGAAG 1 cut(s) 336
AfaI GTAC 3 cut(s) 57, 343, 499
AgsI TTSAA 2 cut(s) 196, 217
AhlI ACTAGT 1 cut(s) 145
AjnI CCWGG 2 cut(s) 202, 307
AluBI AGCT 3 cut(s) 239, 284, 379
AluI AGCT 3 cut(s) 239, 284, 379
AoxI GGCC 1 cut(s) 175
ApeKI GCWGC 4 cut(s) 236, 239, 284, 287
ApoI RAATTY 2 cut(s) 196, 452
ArsI GACNNNNNNTTYG 2 cut(s) 45, 77
AspS9I GGNCC 1 cut(s) 175
AsuHPI GGTGA 1 cut(s) 76
BarI GAAGNNNNNNTAC 2 cut(s) 334, 366
BbvI GCAGC 4 cut(s) 226, 248, 271, 274
BccI CCATC 1 cut(s) 272
BciT130I CCWGG 2 cut(s) 204, 309
BcuI ACTAGT 1 cut(s) 145
BfaI CTAG 3 cut(s) 99, 146, 429
BfuAI ACCTGC 1 cut(s) 485
BisI GCNGC 4 cut(s) 237, 240, 285, 288
BlsI GCNGC 4 cut(s) 238, 241, 286, 289
BmcAI AGTACT 1 cut(s) 343
Bme1390I CCNGG 2 cut(s) 204, 309
BmgT120I GGNCC 1 cut(s) 175
BmrFI CCNGG 2 cut(s) 204, 309
BmsI GCATC 2 cut(s) 195, 517
BpuEI CTTGAG 1 cut(s) 11
BsaJI CCNNGG 2 cut(s) 87, 308
Bse3DI GCAATG 1 cut(s) 181
BseBI CCWGG 2 cut(s) 204, 309
BseDI CCNNGG 2 cut(s) 87, 308
BseGI GGATG 1 cut(s) 186
BseMI GCAATG 1 cut(s) 181
BseXI GCAGC 4 cut(s) 226, 248, 271, 274
BshFI GGCC 1 cut(s) 177
BsnI GGCC 1 cut(s) 177
Bsp143I GATC 1 cut(s) 255
BspANI GGCC 1 cut(s) 177
BspHI TCATGA 1 cut(s) 447
BspMI ACCTGC 1 cut(s) 485
BsrDI GCAATG 1 cut(s) 181
BssECI CCNNGG 2 cut(s) 87, 308
BssMI GATC 1 cut(s) 255
BssT1I CCWWGG 1 cut(s) 87
Bst2UI CCWGG 2 cut(s) 204, 309
Bst4CI ACNGT 2 cut(s) 134, 424
BstC8I GCNNGC 1 cut(s) 381
BstF5I GGATG 1 cut(s) 186
BstKTI GATC 1 cut(s) 258
BstMBI GATC 1 cut(s) 255
BstMWI GCNNNNNNNGC 1 cut(s) 183
BstNI CCWGG 2 cut(s) 204, 309
BstSCI CCNGG 2 cut(s) 202, 307
BstV1I GCAGC 4 cut(s) 226, 248, 271, 274
BsuRI GGCC 1 cut(s) 177
BtsCI GGATG 1 cut(s) 186
BtsI GCAGTG 1 cut(s) 405
BtsIMutI CAGTG 1 cut(s) 405
BveI ACCTGC 1 cut(s) 485
Cac8I GCNNGC 1 cut(s) 381
CciI TCATGA 1 cut(s) 447
Cfr13I GGNCC 1 cut(s) 175
Csp6I GTAC 3 cut(s) 56, 342, 498
CviAII CATG 6 cut(s) 7, 331, 364, 394, 448, 515
CviJI RGCY 7 cut(s) 92, 98, 177, 239, 284, 307, 379
CviKI_1 RGCY 7 cut(s) 92, 98, 177, 239, 284, 307, 379
CviQI GTAC 3 cut(s) 56, 342, 498
DpnI GATC 1 cut(s) 257
DpnII GATC 1 cut(s) 255
Eco130I CCWWGG 1 cut(s) 87
Eco32I GATATC 1 cut(s) 475
Eco57I CTGAAG 1 cut(s) 336
EcoRII CCWGG 2 cut(s) 202, 307
EcoRV GATATC 1 cut(s) 475
EcoT14I CCWWGG 1 cut(s) 87
EcoT22I ATGCAT 1 cut(s) 510
ErhI CCWWGG 1 cut(s) 87
FaeI CATG 6 cut(s) 10, 334, 367, 397, 451, 518
FatI CATG 6 cut(s) 6, 330, 363, 393, 447, 514
Fnu4HI GCNGC 4 cut(s) 237, 240, 285, 288
FokI GGATG 1 cut(s) 173
Fsp4HI GCNGC 4 cut(s) 237, 240, 285, 288
FspBI CTAG 3 cut(s) 99, 146, 429
GluI GCNGC 4 cut(s) 237, 240, 285, 288
HaeIII GGCC 1 cut(s) 177
Hin1II CATG 6 cut(s) 10, 334, 367, 397, 451, 518
HinfI GANTC 2 cut(s) 105, 347
HphI GGTGA 1 cut(s) 76
Hpy188III TCNNGA 2 cut(s) 28, 448
HpyAV CCTTC 1 cut(s) 35
HpyCH4III ACNGT 2 cut(s) 134, 424
HpyCH4V TGCA 4 cut(s) 186, 338, 494, 508
HpyF10VI GCNNNNNNNGC 1 cut(s) 183
Hsp92II CATG 6 cut(s) 10, 334, 367, 397, 451, 518
Kzo9I GATC 1 cut(s) 255
LmnI GCTCC 1 cut(s) 233
Lsp1109I GCAGC 4 cut(s) 226, 248, 271, 274
LweI GCATC 2 cut(s) 195, 517
MaeI CTAG 3 cut(s) 99, 146, 429
MaeIII GTNAC 2 cut(s) 136, 314
MalI GATC 1 cut(s) 257
MboI GATC 1 cut(s) 255
MboII GAAGA 4 cut(s) 73, 289, 342, 503
MluCI AATT 2 cut(s) 196, 452
MmeI TCCRAC 1 cut(s) 439
MnlI CCTC 2 cut(s) 115, 188
Mph1103I ATGCAT 1 cut(s) 510
MseI TTAA 3 cut(s) 296, 437, 520
MslI CAYNNNNRTG 1 cut(s) 513
MspA1I CMGCKG 1 cut(s) 239
MspR9I CCNGG 2 cut(s) 204, 309
MvaI CCWGG 2 cut(s) 204, 309
MwoI GCNNNNNNNGC 1 cut(s) 183
NdeII GATC 1 cut(s) 255
NlaIII CATG 6 cut(s) 10, 334, 367, 397, 451, 518
NmuCI GTSAC 2 cut(s) 136, 314
NsiI ATGCAT 1 cut(s) 510
PagI TCATGA 1 cut(s) 447
PfeI GAWTC 2 cut(s) 105, 347
PfoI TCCNGGA 1 cut(s) 202
PkrI GCNGC 4 cut(s) 238, 241, 286, 289
Psp6I CCWGG 2 cut(s) 202, 307
PspGI CCWGG 2 cut(s) 202, 307
PspPI GGNCC 1 cut(s) 175
PvuII CAGCTG 1 cut(s) 239
RsaI GTAC 3 cut(s) 57, 343, 499
RsaNI GTAC 3 cut(s) 56, 342, 498
RseI CAYNNNNRTG 1 cut(s) 513
SaqAI TTAA 3 cut(s) 296, 437, 520
SatI GCNGC 4 cut(s) 237, 240, 285, 288
Sau3AI GATC 1 cut(s) 255
Sau96I GGNCC 1 cut(s) 175
ScaI AGTACT 1 cut(s) 343
ScrFI CCNGG 2 cut(s) 204, 309
SetI ASST 7 cut(s) 89, 241, 286, 381, 393, 443, 499
SfaNI GCATC 2 cut(s) 195, 517
SmiMI CAYNNNNRTG 1 cut(s) 513
SmlI CTYRAG 1 cut(s) 26
SmoI CTYRAG 1 cut(s) 26
SpeI ACTAGT 1 cut(s) 145
Sse9I AATT 2 cut(s) 196, 452
SspMI CTAG 3 cut(s) 99, 146, 429
StyD4I CCNGG 2 cut(s) 202, 307
StyI CCWWGG 1 cut(s) 87
TaaI ACNGT 2 cut(s) 134, 424
TasI AATT 2 cut(s) 196, 452
TatI WGTACW 2 cut(s) 55, 341
TfiI GAWTC 2 cut(s) 105, 347
Tru1I TTAA 3 cut(s) 296, 437, 520
Tru9I TTAA 3 cut(s) 296, 437, 520
TscAI CASTG 1 cut(s) 412
TseFI GTSAC 2 cut(s) 136, 314
TseI GCWGC 4 cut(s) 236, 239, 284, 287
Tsp45I GTSAC 2 cut(s) 136, 314
TspDTI ATGAA 3 cut(s) 352, 464, 503
TspRI CASTG 1 cut(s) 412
XapI RAATTY 2 cut(s) 196, 452
XspI CTAG 3 cut(s) 99, 146, 429
ZrmI AGTACT 1 cut(s) 343
Zsp2I ATGCAT 1 cut(s) 510
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.