Rh5DG535000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Reverse (-)
82439552 .. 82448605
9054 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG535000.1

Sequence Viewer

Length: 193 bp
ATGATCGCCGGTCTCCAGAACGATTCAGAGCCTCCAGAAGTTTTCTGGGTCGTTGATCAGATCGAAGCTTTGAGGTCGTTTGTGGCATCTTTGAAGAAAAGAATCAATCAATCGCATTTCTCAATTCAAGGGTGTTTTTGGTTTTTTCAAAAGGACAGAACTGTTGTTGGCAAGTGGACTAAGAAATTTCCAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

64

Amino Acids

7.52

Weight (kDa)

9.43

Isoelectric Point (pI)

47.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 185
AgsI TTSAA 3 cut(s) 94, 128, 149
AluBI AGCT 1 cut(s) 68
AluI AGCT 1 cut(s) 68
Alw26I GTCTC 1 cut(s) 17
ApoI RAATTY 1 cut(s) 185
BclI TGATCA 1 cut(s) 55
BcoDI GTCTC 1 cut(s) 17
BmsI GCATC 1 cut(s) 95
BpmI CTGGAG 1 cut(s) 18
BsaI GGTCTC 1 cut(s) 17
Bse118I RCCGGY 1 cut(s) 8
BsiSI CCGG 1 cut(s) 9
BsmAI GTCTC 1 cut(s) 17
Bso31I GGTCTC 1 cut(s) 17
Bsp143I GATC 3 cut(s) 3, 55, 60
BspTNI GGTCTC 1 cut(s) 17
BsrFI RCCGGY 1 cut(s) 8
BssAI RCCGGY 1 cut(s) 8
BssMI GATC 3 cut(s) 3, 55, 60
Bst4CI ACNGT 1 cut(s) 163
BstDEI CTNAG 1 cut(s) 180
BstKTI GATC 3 cut(s) 6, 58, 63
BstMAI GTCTC 1 cut(s) 17
BstMBI GATC 3 cut(s) 3, 55, 60
Cfr10I RCCGGY 1 cut(s) 8
CviJI RGCY 2 cut(s) 31, 68
CviKI_1 RGCY 2 cut(s) 31, 68
DdeI CTNAG 1 cut(s) 180
DpnI GATC 3 cut(s) 5, 57, 62
DpnII GATC 3 cut(s) 3, 55, 60
Eco31I GGTCTC 1 cut(s) 17
FbaI TGATCA 1 cut(s) 55
GsuI CTGGAG 1 cut(s) 18
HapII CCGG 1 cut(s) 9
HindIII AAGCTT 1 cut(s) 66
HinfI GANTC 2 cut(s) 23, 102
HpaII CCGG 1 cut(s) 9
Hpy166II GTNNAC 1 cut(s) 177
Hpy188I TCNGA 2 cut(s) 28, 60
Hpy188III TCNNGA 2 cut(s) 16, 35
Hpy8I GTNNAC 1 cut(s) 177
HpyCH4III ACNGT 1 cut(s) 163
HpyF3I CTNAG 1 cut(s) 180
Ksp22I TGATCA 1 cut(s) 55
Kzo9I GATC 3 cut(s) 3, 55, 60
LpnPI CCDG 4 cut(s) 22, 29, 31, 48
LweI GCATC 1 cut(s) 95
MalI GATC 3 cut(s) 5, 57, 62
MboI GATC 3 cut(s) 3, 55, 60
MboII GAAGA 1 cut(s) 106
MluCI AATT 2 cut(s) 123, 185
MnlI CCTC 2 cut(s) 42, 66
MspI CCGG 1 cut(s) 9
NdeII GATC 3 cut(s) 3, 55, 60
PfeI GAWTC 2 cut(s) 23, 102
Sau3AI GATC 3 cut(s) 3, 55, 60
SetI ASST 2 cut(s) 70, 77
SfaNI GCATC 1 cut(s) 95
SgeI CNNG 6 cut(s) 21, 28, 47, 58, 140, 184
Sse9I AATT 2 cut(s) 123, 185
TaaI ACNGT 1 cut(s) 163
TaqI TCGA 1 cut(s) 63
TasI AATT 2 cut(s) 123, 185
TfiI GAWTC 2 cut(s) 23, 102
XapI RAATTY 1 cut(s) 185
XcmI CCANNNNNNNNNTGG 1 cut(s) 42
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.