Rh6CG312500

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
OG0010631
Physical Location & Seq
Reverse (-)
49656477 .. 49656755
279 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG312500.1

Sequence Viewer

Length: 279 bp
ATGGCATGGCTTACGCGTGGCAGGCAACTCCGATCCCGTTTTCCCTTAAAAGGTTTCATGCATGCAAACCCTCCGTACTCCAAACCTACTTCACAATCACATCCCATTCTCATGGAAGACGCCCCTCGCTCCCCACATTCTCCCCTAGCTGATGAGCAGCATGGAGAGCTTTTTCTCCATTTACGTCCGCCAGCCAGCTGGTTGGGTATCTCATCTCTTATCGTAGTCATAACCCACAGGCGGTCATCCGTATCCTTACACAGGCCTGGGCTGCGATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

92

Amino Acids

10.45

Weight (kDa)

11.65

Isoelectric Point (pI)

82.96

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 16
AciI CCGC 2 cut(s) 188, 241
AclWI GGATC 1 cut(s) 27
AcyI GRCGYC 1 cut(s) 120
AfaI GTAC 1 cut(s) 77
AfiI CCNNNNNNNGG 3 cut(s) 50, 240, 261
AflIII ACRYGT 1 cut(s) 14
AjnI CCWGG 1 cut(s) 265
AluBI AGCT 3 cut(s) 149, 169, 198
AluI AGCT 3 cut(s) 149, 169, 198
AlwI GGATC 1 cut(s) 27
AoxI GGCC 1 cut(s) 263
ApeKI GCWGC 2 cut(s) 157, 271
BbsI GAAGAC 1 cut(s) 123
BbvI GCAGC 2 cut(s) 169, 258
BciT130I CCWGG 1 cut(s) 267
BciVI GTATCC 1 cut(s) 262
BfaI CTAG 1 cut(s) 146
BfuI GTATCC 1 cut(s) 262
BisI GCNGC 2 cut(s) 158, 272
BlsI GCNGC 2 cut(s) 159, 273
Bme1390I CCNGG 1 cut(s) 267
BmrFI CCNGG 1 cut(s) 267
BpiI GAAGAC 1 cut(s) 123
BsaHI GRCGYC 1 cut(s) 120
BsaJI CCNNGG 1 cut(s) 266
Bsc4I CCNNNNNNNGG 3 cut(s) 50, 240, 261
BseBI CCWGG 1 cut(s) 267
BseDI CCNNGG 1 cut(s) 266
BseGI GGATG 2 cut(s) 100, 245
BseLI CCNNNNNNNGG 3 cut(s) 50, 240, 261
BseXI GCAGC 2 cut(s) 169, 258
Bsh1236I CGCG 1 cut(s) 16
BshFI GGCC 1 cut(s) 265
BslI CCNNNNNNNGG 3 cut(s) 50, 240, 261
BsnI GGCC 1 cut(s) 265
Bsp143I GATC 1 cut(s) 32
BspACI CCGC 2 cut(s) 188, 241
BspANI GGCC 1 cut(s) 265
BspFNI CGCG 1 cut(s) 16
BspPI GGATC 1 cut(s) 27
BssECI CCNNGG 1 cut(s) 266
BssMI GATC 1 cut(s) 32
BssNI GRCGYC 1 cut(s) 120
Bst2UI CCWGG 1 cut(s) 267
BstACI GRCGYC 1 cut(s) 120
BstC8I GCNNGC 4 cut(s) 23, 63, 192, 196
BstENI CCTNNNNNAGG 1 cut(s) 259
BstF5I GGATG 2 cut(s) 100, 245
BstFNI CGCG 1 cut(s) 16
BstKTI GATC 1 cut(s) 35
BstMBI GATC 1 cut(s) 32
BstMWI GCNNNNNNNGC 3 cut(s) 22, 166, 271
BstNI CCWGG 1 cut(s) 267
BstNSI RCATGY 1 cut(s) 65
BstSCI CCNGG 1 cut(s) 265
BstUI CGCG 1 cut(s) 16
BstV1I GCAGC 2 cut(s) 169, 258
BstV2I GAAGAC 1 cut(s) 123
BstXI CCANNNNNNTGG 3 cut(s) 112, 198, 202
BsuI GTATCC 1 cut(s) 262
BsuRI GGCC 1 cut(s) 265
BtsCI GGATG 2 cut(s) 100, 245
Cac8I GCNNGC 4 cut(s) 23, 63, 192, 196
CseI GACGC 1 cut(s) 128
Csp6I GTAC 1 cut(s) 76
CviAII CATG 5 cut(s) 6, 58, 62, 112, 161
CviJI RGCY 7 cut(s) 10, 149, 169, 194, 198, 265, 271
CviKI_1 RGCY 7 cut(s) 10, 149, 169, 194, 198, 265, 271
CviQI GTAC 1 cut(s) 76
DpnI GATC 1 cut(s) 34
DpnII GATC 1 cut(s) 32
EciI GGCGGA 1 cut(s) 177
Eco147I AGGCCT 1 cut(s) 265
EcoNI CCTNNNNNAGG 1 cut(s) 259
EcoRII CCWGG 1 cut(s) 265
EcoT22I ATGCAT 1 cut(s) 63
FaeI CATG 5 cut(s) 9, 61, 65, 115, 164
FaiI YATR 6 cut(s) 7, 59, 63, 113, 162, 230
FatI CATG 5 cut(s) 5, 57, 61, 111, 160
Fnu4HI GCNGC 2 cut(s) 158, 272
FokI GGATG 2 cut(s) 87, 232
Fsp4HI GCNGC 2 cut(s) 158, 272
FspBI CTAG 1 cut(s) 146
GluI GCNGC 2 cut(s) 158, 272
HaeIII GGCC 1 cut(s) 265
HgaI GACGC 1 cut(s) 128
Hin1I GRCGYC 1 cut(s) 120
Hin1II CATG 5 cut(s) 9, 61, 65, 115, 164
Hpy188I TCNGA 1 cut(s) 32
HpyCH4IV ACGT 1 cut(s) 184
HpyCH4V TGCA 2 cut(s) 61, 65
HpyF10VI GCNNNNNNNGC 3 cut(s) 22, 166, 271
HpySE526I ACGT 1 cut(s) 184
Hsp92I GRCGYC 1 cut(s) 120
Hsp92II CATG 5 cut(s) 9, 61, 65, 115, 164
Kzo9I GATC 1 cut(s) 32
LmnI GCTCC 1 cut(s) 134
LpnPI CCDG 7 cut(s) 7, 184, 204, 208, 223, 247, 252
Lsp1109I GCAGC 2 cut(s) 169, 258
MaeI CTAG 1 cut(s) 146
MaeII ACGT 1 cut(s) 184
MalI GATC 1 cut(s) 34
MboI GATC 1 cut(s) 32
MboII GAAGA 1 cut(s) 128
MluI ACGCGT 1 cut(s) 14
MnlI CCTC 2 cut(s) 81, 135
Mph1103I ATGCAT 1 cut(s) 63
MseI TTAA 1 cut(s) 47
MslI CAYNNNNRTG 1 cut(s) 110
MspA1I CMGCKG 1 cut(s) 198
MspR9I CCNGG 1 cut(s) 267
MvaI CCWGG 1 cut(s) 267
MvnI CGCG 1 cut(s) 16
MwoI GCNNNNNNNGC 3 cut(s) 22, 166, 271
NdeII GATC 1 cut(s) 32
NlaIII CATG 5 cut(s) 9, 61, 65, 115, 164
NsiI ATGCAT 1 cut(s) 63
NspI RCATGY 1 cut(s) 65
PaeI GCATGC 1 cut(s) 65
PceI AGGCCT 1 cut(s) 265
PkrI GCNGC 2 cut(s) 159, 273
Psp6I CCWGG 1 cut(s) 265
PspGI CCWGG 1 cut(s) 265
PvuII CAGCTG 1 cut(s) 198
RsaI GTAC 1 cut(s) 77
RsaNI GTAC 1 cut(s) 76
RseI CAYNNNNRTG 1 cut(s) 110
SaqAI TTAA 1 cut(s) 47
SatI GCNGC 2 cut(s) 158, 272
Sau3AI GATC 1 cut(s) 32
ScrFI CCNGG 1 cut(s) 267
SetI ASST 6 cut(s) 55, 88, 151, 171, 187, 200
SmiMI CAYNNNNRTG 1 cut(s) 110
SphI GCATGC 1 cut(s) 65
SseBI AGGCCT 1 cut(s) 265
SsiI CCGC 2 cut(s) 188, 241
SspMI CTAG 1 cut(s) 146
StuI AGGCCT 1 cut(s) 265
StyD4I CCNGG 1 cut(s) 265
TaiI ACGT 1 cut(s) 187
Tru1I TTAA 1 cut(s) 47
Tru9I TTAA 1 cut(s) 47
TseI GCWGC 2 cut(s) 157, 271
TspDTI ATGAA 1 cut(s) 46
TspGWI ACGGA 2 cut(s) 63, 238
XagI CCTNNNNNAGG 1 cut(s) 259
XceI RCATGY 1 cut(s) 65
XspI CTAG 1 cut(s) 146
Zsp2I ATGCAT 1 cut(s) 63
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.