Rh7CG203900

21 kDa protein-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
OG0009725
Physical Location & Seq
Forward (+)
18122864 .. 18123349
486 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG203900.1

Sequence Viewer

Length: 486 bp
ATGCCACAAGGTTTCCTAACTTGTGCTACAACTCTCTCAAAATCTACTCAAGAGAAATCCAAACCAAACCCTAAAATACTAGCTCATACCGCTCTCAGCGTAGCTTTTGAATTTACCAAACAAACTCATGCAACAGTGAAAAAGTTTTCAACATTTCAAGGTTTAGGTCCACTAGTGAGACCAACAATCTGTGATTACGGGAAGCAACTTGATATCACTGTGGAGGAGCTCCAAAATTCTAAAGATCAACTATGTAAAATAGTTCAAGTCTCTAATTCTGGATTTCAAATAAGCAATTTTCAAACATGGGTTAGTGGTGCACTAACAAATGAGAATACATGCATGGATGGCTTTGGCGAGATCACTCTAAAGGGGAAAGTGGAGATTGTTTCTTATAGGCACATAGCTAAAGTTGCACAATTAACGATCAATGCCTTGACACTCATCAACAGTTATGTTGTATCAACTGAAGTTTCCTTGCATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PMEI

Protein Analysis

161

Amino Acids

17.68

Weight (kDa)

8.68

Isoelectric Point (pI)

21.48

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PMEI PF04043 7 - 148 6.7e-20 Plant invertase/pectin methylesterase inhibitor
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 92
AciI CCGC 1 cut(s) 90
AcsI RAATTY 2 cut(s) 110, 235
AgsI TTSAA 6 cut(s) 110, 150, 158, 266, 287, 302
AhlI ACTAGT 1 cut(s) 172
AluBI AGCT 4 cut(s) 83, 104, 229, 407
AluI AGCT 4 cut(s) 83, 104, 229, 407
Alw21I GWGCWC 2 cut(s) 231, 322
Alw26I GTCTC 2 cut(s) 172, 274
Alw44I GTGCAC 1 cut(s) 318
ApaLI GTGCAC 1 cut(s) 318
ApoI RAATTY 2 cut(s) 110, 235
AspS9I GGNCC 1 cut(s) 167
AvaII GGWCC 1 cut(s) 167
BaeGI GKGCMC 1 cut(s) 322
BanII GRGCYC 1 cut(s) 231
Bbv12I GWGCWC 2 cut(s) 231, 322
BccI CCATC 1 cut(s) 341
BcoDI GTCTC 2 cut(s) 172, 274
BcuI ACTAGT 1 cut(s) 172
BfaI CTAG 2 cut(s) 80, 173
Bme18I GGWCC 1 cut(s) 167
BmgT120I GGNCC 1 cut(s) 167
BpuEI CTTGAG 1 cut(s) 33
BsaI GGTCTC 1 cut(s) 172
BseGI GGATG 1 cut(s) 352
BseMII CTCAG 1 cut(s) 109
BseRI GAGGAG 1 cut(s) 239
BseSI GKGCMC 1 cut(s) 322
BsiHKAI GWGCWC 2 cut(s) 231, 322
BsmAI GTCTC 2 cut(s) 172, 274
Bso31I GGTCTC 1 cut(s) 172
Bsp1286I GDGCHC 2 cut(s) 231, 322
Bsp143I GATC 3 cut(s) 244, 360, 426
BspACI CCGC 1 cut(s) 90
BspCNI CTCAG 1 cut(s) 108
BspTNI GGTCTC 1 cut(s) 172
BsrBI CCGCTC 1 cut(s) 92
BssMI GATC 3 cut(s) 244, 360, 426
Bst4CI ACNGT 3 cut(s) 136, 220, 452
BstDEI CTNAG 1 cut(s) 95
BstF5I GGATG 1 cut(s) 352
BstKTI GATC 3 cut(s) 247, 363, 429
BstMAI GTCTC 2 cut(s) 172, 274
BstMBI GATC 3 cut(s) 244, 360, 426
BstMWI GCNNNNNNNGC 3 cut(s) 89, 348, 413
BstNSI RCATGY 1 cut(s) 342
BstSLI GKGCMC 1 cut(s) 322
BtsCI GGATG 1 cut(s) 352
BtsIMutI CAGTG 2 cut(s) 141, 216
Cfr13I GGNCC 1 cut(s) 167
CviAII CATG 4 cut(s) 128, 306, 339, 343
CviJI RGCY 5 cut(s) 83, 104, 229, 351, 407
CviKI_1 RGCY 5 cut(s) 83, 104, 229, 351, 407
DdeI CTNAG 1 cut(s) 95
DpnI GATC 3 cut(s) 246, 362, 428
DpnII GATC 3 cut(s) 244, 360, 426
Ecl136II GAGCTC 1 cut(s) 229
Eco24I GRGCYC 1 cut(s) 231
Eco31I GGTCTC 1 cut(s) 172
Eco32I GATATC 1 cut(s) 214
Eco47I GGWCC 1 cut(s) 167
Eco53kI GAGCTC 1 cut(s) 229
EcoICRI GAGCTC 1 cut(s) 229
EcoRV GATATC 1 cut(s) 214
EcoT22I ATGCAT 1 cut(s) 344
EcoT38I GRGCYC 1 cut(s) 231
FaeI CATG 4 cut(s) 131, 309, 342, 346
FaiI YATR 9 cut(s) 87, 129, 253, 307, 340, 344, 396, 404, 456
FatI CATG 4 cut(s) 127, 305, 338, 342
FokI GGATG 1 cut(s) 359
FriOI GRGCYC 1 cut(s) 231
FspBI CTAG 2 cut(s) 80, 173
Hin1II CATG 4 cut(s) 131, 309, 342, 346
Hpy166II GTNNAC 2 cut(s) 170, 320
Hpy188III TCNNGA 2 cut(s) 50, 279
Hpy8I GTNNAC 2 cut(s) 170, 320
HpyCH4III ACNGT 3 cut(s) 136, 220, 452
HpyCH4V TGCA 5 cut(s) 131, 320, 342, 416, 481
HpyF10VI GCNNNNNNNGC 3 cut(s) 89, 348, 413
HpyF3I CTNAG 1 cut(s) 95
Hsp92II CATG 4 cut(s) 131, 309, 342, 346
Kzo9I GATC 3 cut(s) 244, 360, 426
LmnI GCTCC 2 cut(s) 226, 234
LpnPI CCDG 1 cut(s) 264
MaeI CTAG 2 cut(s) 80, 173
MalI GATC 3 cut(s) 246, 362, 428
MbiI CCGCTC 1 cut(s) 92
MboI GATC 3 cut(s) 244, 360, 426
MhlI GDGCHC 2 cut(s) 231, 322
MluCI AATT 5 cut(s) 110, 235, 274, 295, 419
MnlI CCTC 1 cut(s) 217
Mph1103I ATGCAT 1 cut(s) 344
MseI TTAA 2 cut(s) 422, 484
MwoI GCNNNNNNNGC 3 cut(s) 89, 348, 413
NdeII GATC 3 cut(s) 244, 360, 426
NlaIII CATG 4 cut(s) 131, 309, 342, 346
NsiI ATGCAT 1 cut(s) 344
NspI RCATGY 1 cut(s) 342
Psp124BI GAGCTC 1 cut(s) 231
PspPI GGNCC 1 cut(s) 167
SacI GAGCTC 1 cut(s) 231
SaqAI TTAA 2 cut(s) 422, 484
Sau3AI GATC 3 cut(s) 244, 360, 426
Sau96I GGNCC 1 cut(s) 167
SduI GDGCHC 2 cut(s) 231, 322
SetI ASST 7 cut(s) 13, 85, 106, 163, 169, 231, 409
SinI GGWCC 1 cut(s) 167
SmlI CTYRAG 1 cut(s) 48
SmoI CTYRAG 1 cut(s) 48
SpeI ACTAGT 1 cut(s) 172
Sse9I AATT 5 cut(s) 110, 235, 274, 295, 419
SsiI CCGC 1 cut(s) 90
SspMI CTAG 2 cut(s) 80, 173
SstI GAGCTC 1 cut(s) 231
TaaI ACNGT 3 cut(s) 136, 220, 452
TasI AATT 5 cut(s) 110, 235, 274, 295, 419
Tru1I TTAA 2 cut(s) 422, 484
Tru9I TTAA 2 cut(s) 422, 484
TscAI CASTG 2 cut(s) 141, 223
TspRI CASTG 2 cut(s) 141, 223
VneI GTGCAC 1 cut(s) 318
VpaK11BI GGWCC 1 cut(s) 167
XapI RAATTY 2 cut(s) 110, 235
XceI RCATGY 1 cut(s) 342
XspI CTAG 2 cut(s) 80, 173
Zsp2I ATGCAT 1 cut(s) 344
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.