Rw7G028020

21 kDa protein-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr7
OG0009725
Physical Location & Seq
Reverse (-)
37278780 .. 37279130
351 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw7G028020.1

Sequence Viewer

Length: 351 bp
ATGAAAACGTTTTCAACATTTCAAGGTTTGGGTCCTCTAGTGAGACCAACAATCTATGATTGCGTGAAGCAACTTGATATCGCTTTGGAGGAGCTCCAAAATTCTAAAGATGAACTGAGTAAAATAGTTCAAGTCTCTAATTCTGGATTTCATATAAGCAATATTCAAACATGGGTTAGTGTTGCACTGACAAATGAGAACACTTGCATGGATGGCTTTGGCGAGCTCACTCTAAAGGGGAAAGTGAAGACTGTTTCTTATAGGCACATAGCTAAAGTCACACAATTAACGAGCAATGTCCTGGCACTCTTCAATAGTTATGCAGTATCATCTAAAGTTTCTTTGTATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PMEI

Protein Analysis

116

Amino Acids

12.85

Weight (kDa)

8.58

Isoelectric Point (pI)

27.74

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PMEI PF04043 17 - 103 6.7e-19 Plant invertase/pectin methylesterase inhibitor
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 8
AcsI RAATTY 1 cut(s) 100
AgsI TTSAA 5 cut(s) 15, 23, 131, 167, 313
AjnI CCWGG 1 cut(s) 300
AluBI AGCT 3 cut(s) 94, 226, 272
AluI AGCT 3 cut(s) 94, 226, 272
Alw21I GWGCWC 2 cut(s) 96, 228
Alw26I GTCTC 2 cut(s) 37, 139
ApoI RAATTY 1 cut(s) 100
AspS9I GGNCC 1 cut(s) 32
AvaII GGWCC 1 cut(s) 32
BanII GRGCYC 2 cut(s) 96, 228
BbsI GAAGAC 1 cut(s) 254
Bbv12I GWGCWC 2 cut(s) 96, 228
BccI CCATC 1 cut(s) 206
BciT130I CCWGG 1 cut(s) 302
BcoDI GTCTC 2 cut(s) 37, 139
BfaI CTAG 1 cut(s) 38
Bme1390I CCNGG 1 cut(s) 302
Bme18I GGWCC 1 cut(s) 32
BmgT120I GGNCC 1 cut(s) 32
BmiI GGNNCC 1 cut(s) 33
BmrFI CCNGG 1 cut(s) 302
BpiI GAAGAC 1 cut(s) 254
BsaI GGTCTC 1 cut(s) 37
Bse3DI GCAATG 1 cut(s) 301
BseBI CCWGG 1 cut(s) 302
BseGI GGATG 1 cut(s) 217
BseMI GCAATG 1 cut(s) 301
BseMII CTCAG 1 cut(s) 107
BseRI GAGGAG 1 cut(s) 104
BsiHKAI GWGCWC 2 cut(s) 96, 228
BsmAI GTCTC 2 cut(s) 37, 139
Bso31I GGTCTC 1 cut(s) 37
Bsp1286I GDGCHC 2 cut(s) 96, 228
BspCNI CTCAG 1 cut(s) 108
BspLI GGNNCC 1 cut(s) 33
BspTNI GGTCTC 1 cut(s) 37
BsrDI GCAATG 1 cut(s) 301
Bst2UI CCWGG 1 cut(s) 302
Bst4CI ACNGT 1 cut(s) 253
Bst6I CTCTTC 1 cut(s) 314
BstC8I GCNNGC 1 cut(s) 224
BstDEI CTNAG 1 cut(s) 116
BstF5I GGATG 1 cut(s) 217
BstMAI GTCTC 2 cut(s) 37, 139
BstMWI GCNNNNNNNGC 1 cut(s) 213
BstNI CCWGG 1 cut(s) 302
BstSCI CCNGG 1 cut(s) 300
BstV2I GAAGAC 1 cut(s) 254
BtsCI GGATG 1 cut(s) 217
BtsIMutI CAGTG 1 cut(s) 185
Cac8I GCNNGC 1 cut(s) 224
Cfr13I GGNCC 1 cut(s) 32
CviAII CATG 2 cut(s) 171, 208
CviJI RGCY 4 cut(s) 94, 216, 226, 272
CviKI_1 RGCY 4 cut(s) 94, 216, 226, 272
DdeI CTNAG 1 cut(s) 116
Eam1104I CTCTTC 1 cut(s) 314
EarI CTCTTC 1 cut(s) 314
Ecl136II GAGCTC 2 cut(s) 94, 226
Eco24I GRGCYC 2 cut(s) 96, 228
Eco31I GGTCTC 1 cut(s) 37
Eco32I GATATC 1 cut(s) 79
Eco47I GGWCC 1 cut(s) 32
Eco53kI GAGCTC 2 cut(s) 94, 226
EcoICRI GAGCTC 2 cut(s) 94, 226
EcoO109I RGGNCCY 1 cut(s) 32
EcoRII CCWGG 1 cut(s) 300
EcoRV GATATC 1 cut(s) 79
EcoT38I GRGCYC 2 cut(s) 96, 228
FaeI CATG 2 cut(s) 174, 211
FaiI YATR 8 cut(s) 57, 153, 155, 172, 209, 261, 269, 321
FatI CATG 2 cut(s) 170, 207
FokI GGATG 1 cut(s) 224
FriOI GRGCYC 2 cut(s) 96, 228
FspBI CTAG 1 cut(s) 38
Hin1II CATG 2 cut(s) 174, 211
Hpy188III TCNNGA 1 cut(s) 144
HpyCH4III ACNGT 1 cut(s) 253
HpyCH4IV ACGT 1 cut(s) 8
HpyCH4V TGCA 3 cut(s) 185, 207, 323
HpyF10VI GCNNNNNNNGC 1 cut(s) 213
HpyF3I CTNAG 1 cut(s) 116
HpySE526I ACGT 1 cut(s) 8
Hsp92II CATG 2 cut(s) 174, 211
LmnI GCTCC 2 cut(s) 91, 99
LpnPI CCDG 3 cut(s) 129, 287, 314
MaeI CTAG 1 cut(s) 38
MaeII ACGT 1 cut(s) 8
MaeIII GTNAC 1 cut(s) 277
MboII GAAGA 2 cut(s) 259, 301
MhlI GDGCHC 2 cut(s) 96, 228
MluCI AATT 3 cut(s) 100, 139, 284
MnlI CCTC 2 cut(s) 45, 82
MseI TTAA 2 cut(s) 287, 349
MslI CAYNNNNRTG 1 cut(s) 206
MspR9I CCNGG 1 cut(s) 302
MvaI CCWGG 1 cut(s) 302
MwoI GCNNNNNNNGC 1 cut(s) 213
NlaIII CATG 2 cut(s) 174, 211
NlaIV GGNNCC 1 cut(s) 33
NmuCI GTSAC 1 cut(s) 277
PpuMI RGGWCCY 1 cut(s) 32
Psp124BI GAGCTC 2 cut(s) 96, 228
Psp1406I AACGTT 1 cut(s) 8
Psp5II RGGWCCY 1 cut(s) 32
Psp6I CCWGG 1 cut(s) 300
PspGI CCWGG 1 cut(s) 300
PspN4I GGNNCC 1 cut(s) 33
PspPI GGNCC 1 cut(s) 32
PspPPI RGGWCCY 1 cut(s) 32
RseI CAYNNNNRTG 1 cut(s) 206
SacI GAGCTC 2 cut(s) 96, 228
SaqAI TTAA 2 cut(s) 287, 349
Sau96I GGNCC 1 cut(s) 32
ScrFI CCNGG 1 cut(s) 302
SduI GDGCHC 2 cut(s) 96, 228
SetI ASST 5 cut(s) 11, 28, 96, 228, 274
SinI GGWCC 1 cut(s) 32
SmiMI CAYNNNNRTG 1 cut(s) 206
Sse9I AATT 3 cut(s) 100, 139, 284
SspI AATATT 1 cut(s) 163
SspMI CTAG 1 cut(s) 38
SstI GAGCTC 2 cut(s) 96, 228
StyD4I CCNGG 1 cut(s) 300
TaaI ACNGT 1 cut(s) 253
TaiI ACGT 1 cut(s) 11
TasI AATT 3 cut(s) 100, 139, 284
Tru1I TTAA 2 cut(s) 287, 349
Tru9I TTAA 2 cut(s) 287, 349
TscAI CASTG 1 cut(s) 192
TseFI GTSAC 1 cut(s) 277
Tsp45I GTSAC 1 cut(s) 277
TspDTI ATGAA 3 cut(s) 17, 126, 140
TspRI CASTG 1 cut(s) 192
VpaK11BI GGWCC 1 cut(s) 32
XapI RAATTY 1 cut(s) 100
XspI CTAG 1 cut(s) 38
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.