Rh7CG365500

DNA repair protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
Physical Location & Seq
Forward (+)
45532192 .. 45532985
794 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG365500.1

Sequence Viewer

Length: 189 bp
ATGGAGTTTGAATCCGCAGTTTATGCAAAGTTTCTTGGGGTCTTGAATTTAAAGAAGGCCAAACTAAGAGAGCTTCGGGACAAGCTCTCAAAACAAGAAGCGGCTGGGAAACTCACACTTGTCCATCCAAATTTCAGCATGTTTCTATCTAGTAGGTCTCGAGGTCGAAAGAGGGCATTGGAGAAATAG

Protein Analysis

62

Amino Acids

7.12

Weight (kDa)

10.55

Isoelectric Point (pI)

37.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 15, 101
AcsI RAATTY 2 cut(s) 46, 130
AgsI TTSAA 2 cut(s) 11, 46
AluBI AGCT 2 cut(s) 73, 85
AluI AGCT 2 cut(s) 73, 85
Alw26I GTCTC 1 cut(s) 162
Ama87I CYCGRG 1 cut(s) 159
AoxI GGCC 1 cut(s) 57
ApoI RAATTY 2 cut(s) 46, 130
AvaI CYCGRG 1 cut(s) 159
BccI CCATC 1 cut(s) 132
BcoDI GTCTC 1 cut(s) 162
BfaI CTAG 1 cut(s) 150
BisI GCNGC 1 cut(s) 102
BlsI GCNGC 1 cut(s) 103
BmeT110I CYCGRG 1 cut(s) 159
BsaI GGTCTC 1 cut(s) 162
BseGI GGATG 1 cut(s) 124
BseYI CCCAGC 1 cut(s) 104
BshFI GGCC 1 cut(s) 59
BsiHKCI CYCGRG 1 cut(s) 159
BslFI GGGAC 1 cut(s) 92
BsmAI GTCTC 1 cut(s) 162
BsmFI GGGAC 1 cut(s) 92
BsnI GGCC 1 cut(s) 59
Bso31I GGTCTC 1 cut(s) 162
BsoBI CYCGRG 1 cut(s) 159
BspACI CCGC 2 cut(s) 15, 101
BspANI GGCC 1 cut(s) 59
BspTNI GGTCTC 1 cut(s) 162
BstAPI GCANNNNNTGC 1 cut(s) 23
BstDEI CTNAG 1 cut(s) 65
BstF5I GGATG 1 cut(s) 124
BstMAI GTCTC 1 cut(s) 162
BstMWI GCNNNNNNNGC 1 cut(s) 23
BstNSI RCATGY 1 cut(s) 142
BsuRI GGCC 1 cut(s) 59
BtsCI GGATG 1 cut(s) 124
CviAII CATG 1 cut(s) 139
CviJI RGCY 4 cut(s) 59, 73, 85, 104
CviKI_1 RGCY 4 cut(s) 59, 73, 85, 104
DdeI CTNAG 1 cut(s) 65
DraI TTTAAA 1 cut(s) 51
Eco31I GGTCTC 1 cut(s) 162
Eco88I CYCGRG 1 cut(s) 159
FaeI CATG 1 cut(s) 142
FaiI YATR 2 cut(s) 24, 140
FaqI GGGAC 1 cut(s) 92
FatI CATG 1 cut(s) 138
Fnu4HI GCNGC 1 cut(s) 102
FokI GGATG 1 cut(s) 111
Fsp4HI GCNGC 1 cut(s) 102
FspBI CTAG 1 cut(s) 150
GluI GCNGC 1 cut(s) 102
GsaI CCCAGC 1 cut(s) 108
HaeIII GGCC 1 cut(s) 59
Hin1II CATG 1 cut(s) 142
HinfI GANTC 1 cut(s) 11
Hpy188III TCNNGA 3 cut(s) 43, 77, 159
HpyAV CCTTC 1 cut(s) 49
HpyCH4V TGCA 1 cut(s) 26
HpyF10VI GCNNNNNNNGC 1 cut(s) 23
HpyF3I CTNAG 1 cut(s) 65
Hsp92II CATG 1 cut(s) 142
LpnPI CCDG 1 cut(s) 90
MaeI CTAG 1 cut(s) 150
MluCI AATT 2 cut(s) 46, 130
MnlI CCTC 2 cut(s) 155, 165
MseI TTAA 1 cut(s) 50
MwoI GCNNNNNNNGC 1 cut(s) 23
NlaIII CATG 1 cut(s) 142
NspI RCATGY 1 cut(s) 142
PaeR7I CTCGAG 1 cut(s) 159
PfeI GAWTC 1 cut(s) 11
PkrI GCNGC 1 cut(s) 103
PspFI CCCAGC 1 cut(s) 104
SaqAI TTAA 1 cut(s) 50
SatI GCNGC 1 cut(s) 102
SetI ASST 4 cut(s) 75, 87, 158, 166
Sfr274I CTCGAG 1 cut(s) 159
SlaI CTCGAG 1 cut(s) 159
SmlI CTYRAG 1 cut(s) 159
SmoI CTYRAG 1 cut(s) 159
Sse9I AATT 2 cut(s) 46, 130
SsiI CCGC 2 cut(s) 15, 101
SspMI CTAG 1 cut(s) 150
TaqI TCGA 2 cut(s) 160, 166
TasI AATT 2 cut(s) 46, 130
TauI GCSGC 1 cut(s) 104
TfiI GAWTC 1 cut(s) 11
Tru1I TTAA 1 cut(s) 50
Tru9I TTAA 1 cut(s) 50
XapI RAATTY 2 cut(s) 46, 130
XceI RCATGY 1 cut(s) 142
XhoI CTCGAG 1 cut(s) 159
XspI CTAG 1 cut(s) 150
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.