Rh7CG485000

kDa ribonucleoprotein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
Physical Location & Seq
Forward (+)
65261903 .. 65262235
333 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG485000.1

Sequence Viewer

Length: 333 bp
ATGGCTTTGCTTCATCAACCGCTAGCACCTCTACCTTGTCTGCAAAACCCACACCACCTCCCCAAACACAAACCCACAACTCTCTCTGTTTCCGGGCCTCTTTTCTCCCTCTCTCTTTCCTTATCTCACACCCACCGCACTCCCACCTCTTCAATCAGGACCAAAAAGCTTGAATCTTTCGTGCTCCAATTCTCCTCCACAGCCCAGGAAGAAGCCATTGAAGAAAACCCAGTTCTTGTGGAGCCAGAAACTGAAGTGTTCTCTGACACAAGATTGCTTGCCCAGAATGTGCCTTGGACTTGTACCCCTGAAGACATTAGGACCATGTTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

110

Amino Acids

12.32

Weight (kDa)

6.03

Isoelectric Point (pI)

52.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 20, 136
AcuI CTGAAG 2 cut(s) 273, 330
AfaI GTAC 1 cut(s) 304
AgsI TTSAA 3 cut(s) 153, 173, 221
AjnI CCWGG 1 cut(s) 204
AluBI AGCT 1 cut(s) 169
AluI AGCT 1 cut(s) 169
Alw21I GWGCWC 1 cut(s) 186
AlwNI CAGNNNCTG 1 cut(s) 251
AoxI GGCC 1 cut(s) 95
AspS9I GGNCC 3 cut(s) 95, 159, 321
AsuC2I CCSGG 1 cut(s) 94
AsuNHI GCTAGC 1 cut(s) 22
AvaII GGWCC 2 cut(s) 159, 321
BbsI GAAGAC 1 cut(s) 318
Bbv12I GWGCWC 1 cut(s) 186
BciT130I CCWGG 1 cut(s) 206
BcnI CCSGG 1 cut(s) 94
BfaI CTAG 2 cut(s) 23, 331
Bme1390I CCNGG 2 cut(s) 94, 206
Bme18I GGWCC 2 cut(s) 159, 321
BmgT120I GGNCC 3 cut(s) 95, 159, 321
BmiI GGNNCC 1 cut(s) 243
BmrFI CCNGG 2 cut(s) 94, 206
BmrI ACTGGG 1 cut(s) 224
BmtI GCTAGC 1 cut(s) 26
BmuI ACTGGG 1 cut(s) 224
BpiI GAAGAC 1 cut(s) 318
BpuMI CCSGG 1 cut(s) 94
BsaJI CCNNGG 2 cut(s) 204, 293
BsaXI ACNNNNNCTCC 2 cut(s) 42, 72
Bse1I ACTGG 1 cut(s) 230
BseBI CCWGG 1 cut(s) 206
BseDI CCNNGG 2 cut(s) 204, 293
BseNI ACTGG 1 cut(s) 230
BseRI GAGGAG 1 cut(s) 184
BshFI GGCC 1 cut(s) 97
BsiHKAI GWGCWC 1 cut(s) 186
BsiSI CCGG 1 cut(s) 93
BsnI GGCC 1 cut(s) 97
Bsp1286I GDGCHC 1 cut(s) 186
BspACI CCGC 2 cut(s) 20, 136
BspANI GGCC 1 cut(s) 97
BspLI GGNNCC 1 cut(s) 243
BspOI GCTAGC 1 cut(s) 26
BsrI ACTGG 1 cut(s) 230
BssECI CCNNGG 2 cut(s) 204, 293
BssT1I CCWWGG 1 cut(s) 293
Bst2UI CCWGG 1 cut(s) 206
Bst6I CTCTTC 1 cut(s) 154
BstC8I GCNNGC 2 cut(s) 24, 279
BstNI CCWGG 1 cut(s) 206
BstSCI CCNGG 2 cut(s) 92, 204
BstV2I GAAGAC 1 cut(s) 318
BsuRI GGCC 1 cut(s) 97
Cac8I GCNNGC 2 cut(s) 24, 279
CaiI CAGNNNCTG 1 cut(s) 251
Cfr13I GGNCC 3 cut(s) 95, 159, 321
Csp6I GTAC 1 cut(s) 303
CviAII CATG 1 cut(s) 325
CviJI RGCY 6 cut(s) 5, 97, 169, 203, 215, 244
CviKI_1 RGCY 6 cut(s) 5, 97, 169, 203, 215, 244
CviQI GTAC 1 cut(s) 303
Eam1104I CTCTTC 1 cut(s) 154
EarI CTCTTC 1 cut(s) 154
Eco130I CCWWGG 1 cut(s) 293
Eco47I GGWCC 2 cut(s) 159, 321
Eco57I CTGAAG 2 cut(s) 273, 330
EcoRII CCWGG 1 cut(s) 204
EcoT14I CCWWGG 1 cut(s) 293
ErhI CCWWGG 1 cut(s) 293
FaeI CATG 1 cut(s) 328
FaiI YATR 1 cut(s) 326
FatI CATG 1 cut(s) 324
FspBI CTAG 2 cut(s) 23, 331
HaeIII GGCC 1 cut(s) 97
HapII CCGG 1 cut(s) 93
Hin1II CATG 1 cut(s) 328
HindIII AAGCTT 1 cut(s) 167
HinfI GANTC 1 cut(s) 173
HpaII CCGG 1 cut(s) 93
Hpy188I TCNGA 1 cut(s) 265
Hpy188III TCNNGA 1 cut(s) 157
HpyCH4V TGCA 1 cut(s) 43
Hsp92II CATG 1 cut(s) 328
LmnI GCTCC 2 cut(s) 189, 241
LpnPI CCDG 8 cut(s) 106, 142, 191, 218, 243, 258, 296, 321
MaeI CTAG 2 cut(s) 23, 331
MboII GAAGA 4 cut(s) 141, 221, 233, 323
MhlI GDGCHC 1 cut(s) 186
MluCI AATT 1 cut(s) 188
MnlI CCTC 6 cut(s) 39, 68, 108, 119, 157, 205
MspI CCGG 1 cut(s) 93
MspR9I CCNGG 2 cut(s) 94, 206
MvaI CCWGG 1 cut(s) 206
NciI CCSGG 1 cut(s) 94
NheI GCTAGC 1 cut(s) 22
NlaIII CATG 1 cut(s) 328
NlaIV GGNNCC 1 cut(s) 243
PfeI GAWTC 1 cut(s) 173
Psp6I CCWGG 1 cut(s) 204
PspGI CCWGG 1 cut(s) 204
PspN4I GGNNCC 1 cut(s) 243
PspPI GGNCC 3 cut(s) 95, 159, 321
PstNI CAGNNNCTG 1 cut(s) 251
RsaI GTAC 1 cut(s) 304
RsaNI GTAC 1 cut(s) 303
Sau96I GGNCC 3 cut(s) 95, 159, 321
ScrFI CCNGG 2 cut(s) 94, 206
SduI GDGCHC 1 cut(s) 186
SetI ASST 5 cut(s) 31, 37, 60, 149, 171
SinI GGWCC 2 cut(s) 159, 321
Sse9I AATT 1 cut(s) 188
SsiI CCGC 2 cut(s) 20, 136
SspMI CTAG 2 cut(s) 23, 331
StyD4I CCNGG 2 cut(s) 92, 204
StyI CCWWGG 1 cut(s) 293
TasI AATT 1 cut(s) 188
TfiI GAWTC 1 cut(s) 173
VpaK11BI GGWCC 2 cut(s) 159, 321
XspI CTAG 2 cut(s) 23, 331
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.