Rw6G016360

Lignin degradation and detoxification of lignin-derived products

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr6
OG0011519
Physical Location & Seq
Forward (+)
32139187 .. 32140500
1314 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw6G016360.1

Sequence Viewer

Length: 219 bp
ATGGCTTACAACGTTCATCGCTATAGCTTTATCCTTAAGGAGACCAATTTCACGAGACTATGTACCACAAAGCCAATGCTGACTGTAAATGGGCAGTTCCCAGGTCCAACCATTACCGTTCGCAAAGGAGATAGAGCTTTTGTTAATGTCCACAACAAAGGCAAATATGGTGTCACCAGCTCTGGAATGAACGAAATTCAAGTTGCCATGGAAAGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Cu-oxidase Cu-oxidase_2 Cu-oxidase_3

Protein Analysis

72

Amino Acids

8.15

Weight (kDa)

10.01

Isoelectric Point (pI)

13.76

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Cu-oxidase_3 PF07732 13 - 59 1.1e-10 Multicopper oxidase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 12
AcsI RAATTY 1 cut(s) 195
AfaI GTAC 1 cut(s) 64
AfiI CCNNNNNNNGG 1 cut(s) 213
AflII CTTAAG 1 cut(s) 35
AgsI TTSAA 1 cut(s) 200
AjnI CCWGG 1 cut(s) 100
AluBI AGCT 3 cut(s) 27, 137, 180
AluI AGCT 3 cut(s) 27, 137, 180
Alw26I GTCTC 2 cut(s) 35, 49
ApoI RAATTY 1 cut(s) 195
ArsI GACNNNNNNTTYG 2 cut(s) 156, 188
AspS9I GGNCC 1 cut(s) 104
AsuHPI GGTGA 1 cut(s) 166
AvaII GGWCC 1 cut(s) 104
BauI CACGAG 1 cut(s) 52
BciT130I CCWGG 1 cut(s) 102
BcoDI GTCTC 2 cut(s) 35, 49
BfmI CTRYAG 1 cut(s) 22
BfrI CTTAAG 1 cut(s) 35
Bme1390I CCNGG 1 cut(s) 102
Bme18I GGWCC 1 cut(s) 104
BmgT120I GGNCC 1 cut(s) 104
BmrFI CCNGG 1 cut(s) 102
BsaI GGTCTC 1 cut(s) 35
BsaJI CCNNGG 2 cut(s) 100, 207
Bsc4I CCNNNNNNNGG 1 cut(s) 213
BseBI CCWGG 1 cut(s) 102
BseDI CCNNGG 2 cut(s) 100, 207
BseLI CCNNNNNNNGG 1 cut(s) 213
BslI CCNNNNNNNGG 1 cut(s) 213
BsmAI GTCTC 2 cut(s) 35, 49
Bso31I GGTCTC 1 cut(s) 35
Bsp19I CCATGG 1 cut(s) 207
BspTI CTTAAG 1 cut(s) 35
BspTNI GGTCTC 1 cut(s) 35
BssECI CCNNGG 2 cut(s) 100, 207
BssSI CACGAG 1 cut(s) 52
BssT1I CCWWGG 1 cut(s) 207
Bst2BI CACGAG 1 cut(s) 52
Bst2UI CCWGG 1 cut(s) 102
Bst4CI ACNGT 2 cut(s) 85, 118
BstAFI CTTAAG 1 cut(s) 35
BstDSI CCRYGG 1 cut(s) 207
BstMAI GTCTC 2 cut(s) 35, 49
BstNI CCWGG 1 cut(s) 102
BstSCI CCNGG 1 cut(s) 100
BstSFI CTRYAG 1 cut(s) 22
BtgI CCRYGG 1 cut(s) 207
BtgZI GCGATG 1 cut(s) 2
Cfr13I GGNCC 1 cut(s) 104
Csp6I GTAC 1 cut(s) 63
CviAII CATG 1 cut(s) 208
CviJI RGCY 5 cut(s) 5, 27, 73, 137, 180
CviKI_1 RGCY 5 cut(s) 5, 27, 73, 137, 180
CviQI GTAC 1 cut(s) 63
Eco130I CCWWGG 1 cut(s) 207
Eco31I GGTCTC 1 cut(s) 35
Eco47I GGWCC 1 cut(s) 104
EcoRII CCWGG 1 cut(s) 100
EcoT14I CCWWGG 1 cut(s) 207
ErhI CCWWGG 1 cut(s) 207
FaeI CATG 1 cut(s) 211
FaiI YATR 4 cut(s) 24, 61, 168, 209
FatI CATG 1 cut(s) 207
Hin1II CATG 1 cut(s) 211
HphI GGTGA 1 cut(s) 166
Hpy166II GTNNAC 1 cut(s) 151
Hpy188III TCNNGA 2 cut(s) 52, 183
Hpy8I GTNNAC 1 cut(s) 151
HpyCH4III ACNGT 2 cut(s) 85, 118
HpyCH4IV ACGT 1 cut(s) 12
HpySE526I ACGT 1 cut(s) 12
Hsp92II CATG 1 cut(s) 211
LpnPI CCDG 4 cut(s) 87, 114, 168, 190
MaeII ACGT 1 cut(s) 12
MaeIII GTNAC 1 cut(s) 172
MluCI AATT 2 cut(s) 46, 195
MmeI TCCRAC 1 cut(s) 131
MseI TTAA 2 cut(s) 36, 144
MspCI CTTAAG 1 cut(s) 35
MspR9I CCNGG 1 cut(s) 102
MvaI CCWGG 1 cut(s) 102
NcoI CCATGG 1 cut(s) 207
NlaIII CATG 1 cut(s) 211
NmuCI GTSAC 1 cut(s) 172
Psp1406I AACGTT 1 cut(s) 12
Psp6I CCWGG 1 cut(s) 100
PspGI CCWGG 1 cut(s) 100
PspPI GGNCC 1 cut(s) 104
RsaI GTAC 1 cut(s) 64
RsaNI GTAC 1 cut(s) 63
SaqAI TTAA 2 cut(s) 36, 144
Sau96I GGNCC 1 cut(s) 104
ScrFI CCNGG 1 cut(s) 102
SetI ASST 6 cut(s) 15, 29, 106, 139, 182, 218
SfcI CTRYAG 1 cut(s) 22
SgeI CNNG 7 cut(s) 64, 66, 113, 114, 189, 195, 212
SinI GGWCC 1 cut(s) 104
SmlI CTYRAG 1 cut(s) 35
SmoI CTYRAG 1 cut(s) 35
Sse9I AATT 2 cut(s) 46, 195
StyD4I CCNGG 1 cut(s) 100
StyI CCWWGG 1 cut(s) 207
TaaI ACNGT 2 cut(s) 85, 118
TaiI ACGT 1 cut(s) 15
TasI AATT 2 cut(s) 46, 195
Tru1I TTAA 2 cut(s) 36, 144
Tru9I TTAA 2 cut(s) 36, 144
TseFI GTSAC 1 cut(s) 172
Tsp45I GTSAC 1 cut(s) 172
TspDTI ATGAA 2 cut(s) 5, 203
Vha464I CTTAAG 1 cut(s) 35
VpaK11BI GGWCC 1 cut(s) 104
XapI RAATTY 1 cut(s) 195
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.