AT1G62900
ERF Family

Belongs to the class I-like SAM-binding methyltransferase superfamily. Cation-independent O- methyltransferase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
OG0005581
Physical Location & Seq
Forward (+)
23297720 .. 23298682
963 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G62900.1

Sequence Viewer

Length: 618 bp
ATGAGGGTTTTCGAACTCATTGGTTCGAACGAACAATTCGCTGAAATGTTTAACCGGACAATGTCGGAAGCTTCCACATTGATTATGAAGAAGGTTTTAGAAGTTTACAAAGGATTCGAAGATGTAAATACTTTGGTGGATGTGGGAGGAGGAATTGGAACAATCATAGGTCAAGTGACTTCCAAGTATCCTCATATTAAAGGCATCAATTTCGATCTAGCATCGGTTTTAGCCCATGCTCCTTTTAATAAAGGAGTGGAGCATGTTTCAGGAGATATGTTTAAAGAAATTCCAAAAGGAGATGCCATCTTCATGAAATGGATACTACATGATTGGACTGACGAAGATTGTGTAAAGATCCTAAAAAATTATTGGAAAAGTCTTCCCGAGAAAGGAAAAGTGATAATAGTCGAGGTGGTTACGCCCGAGGAACCAAAGATTAACGACATTTCTTCTAACATTGTGTTCGGTATGGACATGCTGATGTTAGCAGTAAGCTCAGGTGGTAAGGAGAGGTCTCTTTCCCAATTCGAGACTCTAGCCTCTGATTCGGGTTTTCTTCGTTGTGAAATCATTTGTCATGCCTTCTCATATAGTGTTATCGAATTACACAAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Dimerisation Methyltransf_2

Protein Analysis

205

Amino Acids

22.93

Weight (kDa)

5.39

Isoelectric Point (pI)

31.02

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Methyltransf_2 PF00891 3 - 186 5.4e-55 O-methyltransferase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 352
AcsI RAATTY 1 cut(s) 288
AfiI CCNNNNNNNGG 1 cut(s) 392
AluBI AGCT 2 cut(s) 71, 498
AluI AGCT 2 cut(s) 71, 498
Alw26I GTCTC 2 cut(s) 522, 527
AlwI GGATC 1 cut(s) 352
Ama87I CYCGRG 2 cut(s) 386, 425
ApoI RAATTY 1 cut(s) 288
AsuII TTCGAA 3 cut(s) 12, 26, 117
AvaI CYCGRG 2 cut(s) 386, 425
BbsI GAAGAC 1 cut(s) 374
BccI CCATC 1 cut(s) 314
BcgI CGANNNNNNTGC 2 cut(s) 193, 227
BciVI GTATCC 2 cut(s) 198, 315
BcoDI GTCTC 2 cut(s) 522, 527
BfaI CTAG 2 cut(s) 218, 539
BfuI GTATCC 2 cut(s) 198, 315
BmeT110I CYCGRG 2 cut(s) 386, 425
BmiI GGNNCC 1 cut(s) 432
BmsI GCATC 3 cut(s) 213, 230, 292
BpiI GAAGAC 1 cut(s) 374
Bpu10I CCTNAGC 1 cut(s) 499
Bpu14I TTCGAA 3 cut(s) 12, 26, 117
BsaI GGTCTC 1 cut(s) 522
BsaJI CCNNGG 1 cut(s) 426
BsaWI WCCGGW 1 cut(s) 54
Bsc4I CCNNNNNNNGG 1 cut(s) 392
BseDI CCNNGG 1 cut(s) 426
BseGI GGATG 1 cut(s) 145
BseLI CCNNNNNNNGG 1 cut(s) 392
BseMII CTCAG 1 cut(s) 513
BseRI GAGGAG 1 cut(s) 162
BsiHKCI CYCGRG 2 cut(s) 386, 425
BsiSI CCGG 1 cut(s) 55
BslI CCNNNNNNNGG 1 cut(s) 392
BsmAI GTCTC 2 cut(s) 522, 527
Bso31I GGTCTC 1 cut(s) 522
BsoBI CYCGRG 2 cut(s) 386, 425
Bsp119I TTCGAA 3 cut(s) 12, 26, 117
Bsp143I GATC 2 cut(s) 214, 357
BspCNI CTCAG 1 cut(s) 512
BspHI TCATGA 1 cut(s) 312
BspLI GGNNCC 1 cut(s) 432
BspPI GGATC 1 cut(s) 352
BspT104I TTCGAA 3 cut(s) 12, 26, 117
BspTNI GGTCTC 1 cut(s) 522
BssECI CCNNGG 1 cut(s) 426
BssMI GATC 2 cut(s) 214, 357
BstBI TTCGAA 3 cut(s) 12, 26, 117
BstDEI CTNAG 1 cut(s) 499
BstF5I GGATG 1 cut(s) 145
BstKTI GATC 2 cut(s) 217, 360
BstMAI GTCTC 2 cut(s) 522, 527
BstMBI GATC 2 cut(s) 214, 357
BstNSI RCATGY 2 cut(s) 266, 481
BstV2I GAAGAC 1 cut(s) 374
BstX2I RGATCY 1 cut(s) 357
BstYI RGATCY 1 cut(s) 357
BsuI GTATCC 2 cut(s) 198, 315
BtsCI GGATG 1 cut(s) 145
CciI TCATGA 1 cut(s) 312
CviAII CATG 6 cut(s) 236, 263, 313, 329, 478, 581
CviJI RGCY 4 cut(s) 71, 233, 498, 542
CviKI_1 RGCY 4 cut(s) 71, 233, 498, 542
DdeI CTNAG 1 cut(s) 499
DpnI GATC 2 cut(s) 216, 359
DpnII GATC 2 cut(s) 214, 357
DraI TTTAAA 1 cut(s) 283
Eco31I GGTCTC 1 cut(s) 522
Eco88I CYCGRG 2 cut(s) 386, 425
FaeI CATG 6 cut(s) 239, 266, 316, 332, 481, 584
FatI CATG 6 cut(s) 235, 262, 312, 328, 477, 580
FokI GGATG 1 cut(s) 152
FspBI CTAG 2 cut(s) 218, 539
HapII CCGG 1 cut(s) 55
Hin1II CATG 6 cut(s) 239, 266, 316, 332, 481, 584
HindIII AAGCTT 1 cut(s) 69
HinfI GANTC 3 cut(s) 114, 535, 548
HpaII CCGG 1 cut(s) 55
Hpy166II GTNNAC 1 cut(s) 106
Hpy188I TCNGA 2 cut(s) 67, 547
Hpy188III TCNNGA 4 cut(s) 270, 313, 386, 532
Hpy8I GTNNAC 1 cut(s) 106
HpyAV CCTTC 2 cut(s) 85, 595
HpyF3I CTNAG 1 cut(s) 499
Hsp92II CATG 6 cut(s) 239, 266, 316, 332, 481, 584
Kzo9I GATC 2 cut(s) 214, 357
LmnI GCTCC 2 cut(s) 244, 259
LpnPI CCDG 3 cut(s) 68, 255, 486
LweI GCATC 3 cut(s) 213, 230, 292
MaeI CTAG 2 cut(s) 218, 539
MaeIII GTNAC 2 cut(s) 175, 418
MalI GATC 2 cut(s) 216, 359
MboI GATC 2 cut(s) 214, 357
MboII GAAGA 7 cut(s) 100, 131, 301, 356, 374, 444, 551
MflI RGATCY 1 cut(s) 357
MluCI AATT 7 cut(s) 35, 153, 208, 288, 367, 527, 605
MlyI GAGTC 1 cut(s) 529
MmeI TCCRAC 1 cut(s) 45
MnlI CCTC 7 cut(s) 140, 143, 201, 406, 421, 507, 553
MseI TTAA 5 cut(s) 51, 198, 246, 282, 441
MslI CAYNNNNRTG 2 cut(s) 311, 482
MspI CCGG 1 cut(s) 55
NdeII GATC 2 cut(s) 214, 357
NlaIII CATG 6 cut(s) 239, 266, 316, 332, 481, 584
NlaIV GGNNCC 1 cut(s) 432
NmuCI GTSAC 1 cut(s) 175
NspI RCATGY 2 cut(s) 266, 481
NspV TTCGAA 3 cut(s) 12, 26, 117
PagI TCATGA 1 cut(s) 312
PfeI GAWTC 2 cut(s) 114, 548
PflFI GACNNNGTC 1 cut(s) 61
PleI GAGTC 1 cut(s) 529
PpsI GAGTC 1 cut(s) 529
PspN4I GGNNCC 1 cut(s) 432
PsuI RGATCY 1 cut(s) 357
PsyI GACNNNGTC 1 cut(s) 61
RseI CAYNNNNRTG 2 cut(s) 311, 482
SaqAI TTAA 5 cut(s) 51, 198, 246, 282, 441
Sau3AI GATC 2 cut(s) 214, 357
SchI GAGTC 1 cut(s) 529
SetI ASST 7 cut(s) 73, 96, 172, 417, 500, 505, 518
SfaNI GCATC 3 cut(s) 213, 230, 292
SfuI TTCGAA 3 cut(s) 12, 26, 117
SmiMI CAYNNNNRTG 2 cut(s) 311, 482
Sse9I AATT 7 cut(s) 35, 153, 208, 288, 367, 527, 605
SspMI CTAG 2 cut(s) 218, 539
TaqI TCGA 7 cut(s) 12, 26, 117, 213, 411, 531, 603
TasI AATT 7 cut(s) 35, 153, 208, 288, 367, 527, 605
TfiI GAWTC 2 cut(s) 114, 548
Tru1I TTAA 5 cut(s) 51, 198, 246, 282, 441
Tru9I TTAA 5 cut(s) 51, 198, 246, 282, 441
TseFI GTSAC 1 cut(s) 175
Tsp45I GTSAC 1 cut(s) 175
TspDTI ATGAA 3 cut(s) 101, 301, 329
Tth111I GACNNNGTC 1 cut(s) 61
XapI RAATTY 1 cut(s) 288
XceI RCATGY 2 cut(s) 266, 481
XspI CTAG 2 cut(s) 218, 539
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.