Rroxscaffold_7G00171940
ERF Family

Belongs to the class I-like SAM-binding methyltransferase superfamily. Cation-independent O- methyltransferase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
OG0005581
Physical Location & Seq
Forward (+)
12299660 .. 12301602
1943 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00171940.1

Sequence Viewer

Length: 483 bp
ATGACAGCATTTGAGTACCCAGAAACAGATGAGAGGTTCAATCGGGTATTCAACCAGGCCTTGTCAAACCACACCACATTGATCTTGGAGAAGATGCTTGACGTTTATAAAGGGTTTGAGGGGATCAATGTGTTGGTTGATGTGGGAGGTGGAATTAGTGTCACCCTTAATCTTATCACCAACAAGTACCCTCACATTAAGGGCATCAATTTCGATTTGCCACGCGTCCTAGCTGATGCTAATGCTCCTTCTTATCCAGGTGTAGAGCATGTTGGGGGAGACATGTTTACAAGTGTCCCACAAGGAGATGCTATATCCATGAAGTGGATTCTTCATGATTGGAGTGATGAACATTGCTTGACACTTCTCAAGAACTGCTGTAAATCTCTCCCTAGCTCTGGAAAAGTGAACTTTGTGGAATCAATTCTTCCTGACCTGATAGTAACGTTACATCCAACATTGTCTGCGAGGACGATTTACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00940 ko01100 ko01110 map00940 map01100 map01110
Pfam Domains
Protein Families
Dimerisation Methyltransf_2

Protein Analysis

160

Amino Acids

17.76

Weight (kDa)

5.39

Isoelectric Point (pI)

23.98

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Methyltransf_2 PF00891 1 - 144 2.8e-47 O-methyltransferase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 108
AccB7I CCANNNNNTGG 1 cut(s) 324
AccII CGCG 1 cut(s) 225
AclI AACGTT 1 cut(s) 446
AclWI GGATC 1 cut(s) 131
AfaI GTAC 2 cut(s) 17, 188
AfiI CCNNNNNNNGG 2 cut(s) 324, 398
AflIII ACRYGT 2 cut(s) 223, 282
AgsI TTSAA 2 cut(s) 40, 52
AjnI CCWGG 2 cut(s) 54, 256
AluBI AGCT 2 cut(s) 233, 396
AluI AGCT 2 cut(s) 233, 396
Alw26I GTCTC 1 cut(s) 273
AlwI GGATC 1 cut(s) 131
AoxI GGCC 1 cut(s) 57
Asp700I GAANNNNTTC 1 cut(s) 423
AsuHPI GGTGA 2 cut(s) 154, 169
BcgI CGANNNNNNTGC 2 cut(s) 193, 227
BciT130I CCWGG 2 cut(s) 56, 258
BcoDI GTCTC 1 cut(s) 273
BfaI CTAG 2 cut(s) 230, 393
Bme1390I CCNGG 2 cut(s) 56, 258
BmrFI CCNGG 2 cut(s) 56, 258
BmsI GCATC 4 cut(s) 84, 213, 226, 298
BpuEI CTTGAG 1 cut(s) 353
Bsc4I CCNNNNNNNGG 2 cut(s) 324, 398
Bse3DI GCAATG 1 cut(s) 352
BseBI CCWGG 2 cut(s) 56, 258
BseGI GGATG 1 cut(s) 451
BseLI CCNNNNNNNGG 2 cut(s) 324, 398
BseMI GCAATG 1 cut(s) 352
Bsh1236I CGCG 1 cut(s) 225
BshFI GGCC 1 cut(s) 59
BslFI GGGAC 1 cut(s) 281
BslI CCNNNNNNNGG 2 cut(s) 324, 398
BsmAI GTCTC 1 cut(s) 273
BsmFI GGGAC 1 cut(s) 281
BsnI GGCC 1 cut(s) 59
Bsp143I GATC 2 cut(s) 81, 123
BspANI GGCC 1 cut(s) 59
BspFNI CGCG 1 cut(s) 225
BspHI TCATGA 1 cut(s) 334
BspPI GGATC 1 cut(s) 131
BsrDI GCAATG 1 cut(s) 352
BssMI GATC 2 cut(s) 81, 123
Bst2UI CCWGG 2 cut(s) 56, 258
BstF5I GGATG 1 cut(s) 451
BstFNI CGCG 1 cut(s) 225
BstKTI GATC 2 cut(s) 84, 126
BstMAI GTCTC 1 cut(s) 273
BstMBI GATC 2 cut(s) 81, 123
BstNI CCWGG 2 cut(s) 56, 258
BstNSI RCATGY 2 cut(s) 272, 286
BstSCI CCNGG 2 cut(s) 54, 256
BstUI CGCG 1 cut(s) 225
BsuRI GGCC 1 cut(s) 59
BtsCI GGATG 1 cut(s) 451
CciI TCATGA 1 cut(s) 334
CseI GACGC 1 cut(s) 214
Csp6I GTAC 2 cut(s) 16, 187
CviAII CATG 4 cut(s) 269, 283, 319, 335
CviJI RGCY 3 cut(s) 59, 233, 396
CviKI_1 RGCY 3 cut(s) 59, 233, 396
CviQI GTAC 2 cut(s) 16, 187
DpnI GATC 2 cut(s) 83, 125
DpnII GATC 2 cut(s) 81, 123
Eco147I AGGCCT 1 cut(s) 59
EcoRII CCWGG 2 cut(s) 54, 256
FaeI CATG 4 cut(s) 272, 286, 322, 338
FaiI YATR 6 cut(s) 108, 270, 284, 314, 320, 336
FaqI GGGAC 1 cut(s) 281
FatI CATG 4 cut(s) 268, 282, 318, 334
FokI GGATG 1 cut(s) 438
FspBI CTAG 2 cut(s) 230, 393
HaeIII GGCC 1 cut(s) 59
HgaI GACGC 1 cut(s) 214
Hin1II CATG 4 cut(s) 272, 286, 322, 338
HinfI GANTC 2 cut(s) 328, 419
HphI GGTGA 2 cut(s) 154, 169
Hpy166II GTNNAC 2 cut(s) 288, 409
Hpy188III TCNNGA 4 cut(s) 335, 370, 399, 431
Hpy8I GTNNAC 2 cut(s) 288, 409
HpyAV CCTTC 1 cut(s) 258
HpyCH4IV ACGT 2 cut(s) 102, 446
HpySE526I ACGT 2 cut(s) 102, 446
Hsp92II CATG 4 cut(s) 272, 286, 322, 338
Kzo9I GATC 2 cut(s) 81, 123
LmnI GCTCC 1 cut(s) 250
LpnPI CCDG 8 cut(s) 33, 41, 68, 243, 270, 384, 444, 449
LweI GCATC 4 cut(s) 84, 213, 226, 298
MaeI CTAG 2 cut(s) 230, 393
MaeII ACGT 2 cut(s) 102, 446
MaeIII GTNAC 3 cut(s) 160, 442, 447
MalI GATC 2 cut(s) 83, 125
MboI GATC 2 cut(s) 81, 123
MboII GAAGA 3 cut(s) 103, 323, 419
MluCI AATT 3 cut(s) 153, 208, 423
MluI ACGCGT 1 cut(s) 223
MmeI TCCRAC 1 cut(s) 479
MnlI CCTC 5 cut(s) 27, 112, 140, 201, 462
MroXI GAANNNNTTC 1 cut(s) 423
MseI TTAA 2 cut(s) 168, 198
MspR9I CCNGG 2 cut(s) 56, 258
MvaI CCWGG 2 cut(s) 56, 258
MvnI CGCG 1 cut(s) 225
NdeII GATC 2 cut(s) 81, 123
NlaIII CATG 4 cut(s) 272, 286, 322, 338
NmuCI GTSAC 1 cut(s) 160
NspI RCATGY 2 cut(s) 272, 286
PagI TCATGA 1 cut(s) 334
PceI AGGCCT 1 cut(s) 59
PciI ACATGT 1 cut(s) 282
PdmI GAANNNNTTC 1 cut(s) 423
PfeI GAWTC 2 cut(s) 328, 419
PflMI CCANNNNNTGG 1 cut(s) 324
PscI ACATGT 1 cut(s) 282
PsiI TTATAA 1 cut(s) 108
Psp1406I AACGTT 1 cut(s) 446
Psp6I CCWGG 2 cut(s) 54, 256
PspGI CCWGG 2 cut(s) 54, 256
RsaI GTAC 2 cut(s) 17, 188
RsaNI GTAC 2 cut(s) 16, 187
SaqAI TTAA 2 cut(s) 168, 198
Sau3AI GATC 2 cut(s) 81, 123
ScrFI CCNGG 2 cut(s) 56, 258
SetI ASST 8 cut(s) 38, 105, 151, 235, 262, 398, 438, 449
SfaNI GCATC 4 cut(s) 84, 213, 226, 298
SmlI CTYRAG 1 cut(s) 368
SmoI CTYRAG 1 cut(s) 368
Sse9I AATT 3 cut(s) 153, 208, 423
SseBI AGGCCT 1 cut(s) 59
SspMI CTAG 2 cut(s) 230, 393
StuI AGGCCT 1 cut(s) 59
StyD4I CCNGG 2 cut(s) 54, 256
TaiI ACGT 2 cut(s) 105, 449
TaqI TCGA 1 cut(s) 213
TasI AATT 3 cut(s) 153, 208, 423
TfiI GAWTC 2 cut(s) 328, 419
Tru1I TTAA 2 cut(s) 168, 198
Tru9I TTAA 2 cut(s) 168, 198
TseFI GTSAC 1 cut(s) 160
Tsp45I GTSAC 1 cut(s) 160
TspDTI ATGAA 3 cut(s) 323, 335, 363
Van91I CCANNNNNTGG 1 cut(s) 324
XceI RCATGY 2 cut(s) 272, 286
XcmI CCANNNNNNNNNTGG 1 cut(s) 82
XmnI GAANNNNTTC 1 cut(s) 423
XspI CTAG 2 cut(s) 230, 393
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.