AT3G25855

No description available

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
3
Physical Location & Seq
Reverse (-)
9459411 .. 9460299
889 bp
Loading structure...
UTR
Exon/CDS
Intron
AT3G25855.1

Sequence Viewer

Length: 339 bp
ATGTCGGAAAAGAAGCAATGTTGTGTTGTGATGAGGATTAACTTGGATTGCAATGCTTGTTGTAGAAAAGCTAGGAGGATTATCATCAATATGAAAGAAGTTGATACACACATGATCAACAAAAAGGAACGTCAAGTAATCCTTTGCGGACGGTTTCGACCATCCGATGTTGCATTAAAACTGCAAAGGAAGATGAAACGGAGGGTTGAGATTCTCGAAGTTGAAGATCTCACCAATGGCCATGGAGGAGAAGAAGGAAGCGAGCACGAGCTACCGTATGAACAGCCACATGAATATTCTAATCAACCTGATCAGATGACCACACCATTGTTGTGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

112

Amino Acids

13.08

Weight (kDa)

8.18

Isoelectric Point (pI)

53.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 147
AcoI YGGCCR 1 cut(s) 238
AgsI TTSAA 1 cut(s) 224
AluBI AGCT 2 cut(s) 71, 271
AluI AGCT 2 cut(s) 71, 271
Alw21I GWGCWC 1 cut(s) 267
AoxI GGCC 1 cut(s) 238
AsuHPI GGTGA 1 cut(s) 223
BalI TGGCCA 1 cut(s) 240
BauI CACGAG 1 cut(s) 266
Bbv12I GWGCWC 1 cut(s) 267
BccI CCATC 1 cut(s) 169
BclI TGATCA 2 cut(s) 114, 310
BfaI CTAG 1 cut(s) 72
BglII AGATCT 1 cut(s) 226
BsaBI GATNNNNATC 1 cut(s) 83
BsaJI CCNNGG 1 cut(s) 241
Bse3DI GCAATG 2 cut(s) 23, 58
Bse8I GATNNNNATC 1 cut(s) 83
BseDI CCNNGG 1 cut(s) 241
BseGI GGATG 1 cut(s) 161
BseJI GATNNNNATC 1 cut(s) 83
BseMI GCAATG 2 cut(s) 23, 58
BseRI GAGGAG 1 cut(s) 261
BshFI GGCC 1 cut(s) 240
BsiHKAI GWGCWC 1 cut(s) 267
BsnI GGCC 1 cut(s) 240
Bsp1286I GDGCHC 1 cut(s) 267
Bsp143I GATC 3 cut(s) 114, 226, 310
Bsp19I CCATGG 1 cut(s) 241
BspACI CCGC 1 cut(s) 147
BspANI GGCC 1 cut(s) 240
BsrDI GCAATG 2 cut(s) 23, 58
BssECI CCNNGG 1 cut(s) 241
BssMI GATC 3 cut(s) 114, 226, 310
BssSI CACGAG 1 cut(s) 266
BssT1I CCWWGG 1 cut(s) 241
Bst2BI CACGAG 1 cut(s) 266
Bst4CI ACNGT 2 cut(s) 153, 276
BstC8I GCNNGC 1 cut(s) 263
BstDSI CCRYGG 1 cut(s) 241
BstF5I GGATG 1 cut(s) 161
BstKTI GATC 3 cut(s) 117, 229, 313
BstMBI GATC 3 cut(s) 114, 226, 310
BstX2I RGATCY 1 cut(s) 226
BstYI RGATCY 1 cut(s) 226
BsuRI GGCC 1 cut(s) 240
BtgI CCRYGG 1 cut(s) 241
BtsCI GGATG 1 cut(s) 161
Cac8I GCNNGC 1 cut(s) 263
CviAII CATG 3 cut(s) 112, 242, 290
CviJI RGCY 4 cut(s) 71, 240, 271, 286
CviKI_1 RGCY 4 cut(s) 71, 240, 271, 286
DpnI GATC 3 cut(s) 116, 228, 312
DpnII GATC 3 cut(s) 114, 226, 310
EaeI YGGCCR 1 cut(s) 238
Eco130I CCWWGG 1 cut(s) 241
EcoT14I CCWWGG 1 cut(s) 241
ErhI CCWWGG 1 cut(s) 241
FaeI CATG 3 cut(s) 115, 245, 293
FaiI YATR 5 cut(s) 92, 113, 243, 279, 291
FalI AAGNNNNNCTT 2 cut(s) 126, 158
FatI CATG 3 cut(s) 111, 241, 289
FbaI TGATCA 2 cut(s) 114, 310
FokI GGATG 1 cut(s) 148
FspBI CTAG 1 cut(s) 72
HaeIII GGCC 1 cut(s) 240
Hin1II CATG 3 cut(s) 115, 245, 293
HinfI GANTC 1 cut(s) 211
HphI GGTGA 1 cut(s) 223
Hpy188I TCNGA 3 cut(s) 7, 166, 315
Hpy188III TCNNGA 1 cut(s) 215
HpyAV CCTTC 1 cut(s) 248
HpyCH4III ACNGT 2 cut(s) 153, 276
HpyCH4IV ACGT 1 cut(s) 130
HpyCH4V TGCA 3 cut(s) 51, 173, 184
HpySE526I ACGT 1 cut(s) 130
Hsp92II CATG 3 cut(s) 115, 245, 293
Ksp22I TGATCA 2 cut(s) 114, 310
Kzo9I GATC 3 cut(s) 114, 226, 310
LpnPI CCDG 1 cut(s) 321
MaeI CTAG 1 cut(s) 72
MaeII ACGT 1 cut(s) 130
MalI GATC 3 cut(s) 116, 228, 312
MboI GATC 3 cut(s) 114, 226, 310
MboII GAAGA 3 cut(s) 202, 236, 263
MflI RGATCY 1 cut(s) 226
MhlI GDGCHC 1 cut(s) 267
MlsI TGGCCA 1 cut(s) 240
MluNI TGGCCA 1 cut(s) 240
MnlI CCTC 4 cut(s) 27, 69, 195, 239
Mox20I TGGCCA 1 cut(s) 240
MscI TGGCCA 1 cut(s) 240
MseI TTAA 2 cut(s) 39, 176
MslI CAYNNNNRTG 2 cut(s) 89, 331
Msp20I TGGCCA 1 cut(s) 240
NcoI CCATGG 1 cut(s) 241
NdeII GATC 3 cut(s) 114, 226, 310
NlaIII CATG 3 cut(s) 115, 245, 293
PfeI GAWTC 1 cut(s) 211
PsuI RGATCY 1 cut(s) 226
RseI CAYNNNNRTG 2 cut(s) 89, 331
SaqAI TTAA 2 cut(s) 39, 176
Sau3AI GATC 3 cut(s) 114, 226, 310
SduI GDGCHC 1 cut(s) 267
SetI ASST 4 cut(s) 73, 133, 273, 310
SmiMI CAYNNNNRTG 2 cut(s) 89, 331
SsiI CCGC 1 cut(s) 147
SspI AATATT 1 cut(s) 296
SspMI CTAG 1 cut(s) 72
StyI CCWWGG 1 cut(s) 241
TaaI ACNGT 2 cut(s) 153, 276
TaiI ACGT 1 cut(s) 133
TaqI TCGA 2 cut(s) 157, 216
TfiI GAWTC 1 cut(s) 211
Tru1I TTAA 2 cut(s) 39, 176
Tru9I TTAA 2 cut(s) 39, 176
TspDTI ATGAA 4 cut(s) 107, 209, 294, 306
TspGWI ACGGA 1 cut(s) 214
XspI CTAG 1 cut(s) 72
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.