AT3G45577

Constitutes one of the two catalytic subunit of the tRNA-splicing endonuclease complex, a complex responsible for identification and cleavage of the splice sites in pre-tRNA. It cleaves pre-tRNA at the 5'- and 3'-splice sites to release the intron. The products are an intron and two tRNA half-molecules bearing 2',3'-cyclic phosphate and 5'-OH termini. There are no conserved sequences at the splice sites, but the intron is invariably located at the same site in the gene, placing the splice sites an invariant distance from the constant structural features of the tRNA body. Probably carries the active site for 5'-splice site cleavage (By similarity)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
3
OG0003092
Physical Location & Seq
Forward (+)
16728701 .. 16729547
847 bp
Loading structure...
UTR
Exon/CDS
Intron
AT3G45577.1

Sequence Viewer

Length: 357 bp
ATGAGTTCACAAACAATTATTCTGTTGTGTAGAGAGAGACTCATCTCCATGGCACCAAGGTGGAAATGGGCTTTAGGTTTCCTCTCAAGTTGTAACGTATTTCTATCAGAGCAAGCTGAGCTTTTGGACCGTTATTGTTTCGGTAGACTAGTTTTTGGTGCCGAGAAAGATAAGAGATGGATTCAGTTATCTTATGAAGAAGCTTTCTTTTTGTTCTACAAACTGAAATGCATCAAGATCTCCCTTCACGGTCGTTCTCTGGTAAACGGGGTAGATTTATGGCGATCCATAAGATCCTTTAAGCCAAATTTTACGATCTTGTACAAAGCTTATTCGCATCTACGATCAAAGAACTAG

Protein Analysis

118

Amino Acids

13.99

Weight (kDa)

9.81

Isoelectric Point (pI)

52.28

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
tRNA_int_endo_N PF02778 26 - 94 4.7e-12 tRNA intron endonuclease, N-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 52, 158
AccI GTMKAC 1 cut(s) 145
AclWI GGATC 2 cut(s) 279, 288
AcsI RAATTY 1 cut(s) 307
AfaI GTAC 1 cut(s) 323
AhlI ACTAGT 1 cut(s) 148
AleI CACNNNNGTG 1 cut(s) 58
AluBI AGCT 4 cut(s) 116, 121, 203, 329
AluI AGCT 4 cut(s) 116, 121, 203, 329
Alw26I GTCTC 1 cut(s) 31
AlwI GGATC 2 cut(s) 279, 288
ApoI RAATTY 1 cut(s) 307
AspS9I GGNCC 1 cut(s) 127
AvaII GGWCC 1 cut(s) 127
BanI GGYRCC 2 cut(s) 52, 158
BccI CCATC 1 cut(s) 171
BcoDI GTCTC 1 cut(s) 31
BcuI ACTAGT 1 cut(s) 148
BfaI CTAG 2 cut(s) 149, 355
BglII AGATCT 1 cut(s) 237
BlpI GCTNAGC 1 cut(s) 117
Bme18I GGWCC 1 cut(s) 127
BmgT120I GGNCC 1 cut(s) 127
BmiI GGNNCC 2 cut(s) 54, 160
BmsI GCATC 2 cut(s) 240, 346
BplI GAGNNNNNCTC 2 cut(s) 24, 56
Bpu1102I GCTNAGC 1 cut(s) 117
BpuEI CTTGAG 1 cut(s) 70
BsaJI CCNNGG 2 cut(s) 48, 56
BseDI CCNNGG 2 cut(s) 48, 56
BseMII CTCAG 1 cut(s) 108
Bsh1285I CGRYCG 1 cut(s) 253
BshNI GGYRCC 2 cut(s) 52, 158
BsiEI CGRYCG 1 cut(s) 253
BsmAI GTCTC 1 cut(s) 31
Bsp1407I TGTACA 1 cut(s) 321
Bsp143I GATC 5 cut(s) 237, 284, 293, 315, 344
Bsp1720I GCTNAGC 1 cut(s) 117
Bsp19I CCATGG 1 cut(s) 48
BspCNI CTCAG 1 cut(s) 109
BspLI GGNNCC 2 cut(s) 54, 160
BspPI GGATC 2 cut(s) 279, 288
BspT107I GGYRCC 2 cut(s) 52, 158
BsrGI TGTACA 1 cut(s) 321
BssECI CCNNGG 2 cut(s) 48, 56
BssMI GATC 5 cut(s) 237, 284, 293, 315, 344
BssT1I CCWWGG 2 cut(s) 48, 56
Bst4CI ACNGT 2 cut(s) 131, 251
BstAUI TGTACA 1 cut(s) 321
BstC8I GCNNGC 1 cut(s) 114
BstDEI CTNAG 1 cut(s) 117
BstDSI CCRYGG 1 cut(s) 48
BstKTI GATC 5 cut(s) 240, 287, 296, 318, 347
BstMAI GTCTC 1 cut(s) 31
BstMBI GATC 5 cut(s) 237, 284, 293, 315, 344
BstMCI CGRYCG 1 cut(s) 253
BstMWI GCNNNNNNNGC 1 cut(s) 118
BstX2I RGATCY 2 cut(s) 237, 293
BstYI RGATCY 2 cut(s) 237, 293
BtgI CCRYGG 1 cut(s) 48
Cac8I GCNNGC 1 cut(s) 114
Cfr13I GGNCC 1 cut(s) 127
Csp6I GTAC 1 cut(s) 322
CviAII CATG 1 cut(s) 49
CviJI RGCY 6 cut(s) 71, 116, 121, 203, 304, 329
CviKI_1 RGCY 6 cut(s) 71, 116, 121, 203, 304, 329
CviQI GTAC 1 cut(s) 322
DdeI CTNAG 1 cut(s) 117
DpnI GATC 5 cut(s) 239, 286, 295, 317, 346
DpnII GATC 5 cut(s) 237, 284, 293, 315, 344
Eco130I CCWWGG 2 cut(s) 48, 56
Eco47I GGWCC 1 cut(s) 127
EcoT14I CCWWGG 2 cut(s) 48, 56
EcoT22I ATGCAT 1 cut(s) 233
ErhI CCWWGG 2 cut(s) 48, 56
FaeI CATG 1 cut(s) 52
FaiI YATR 4 cut(s) 50, 195, 280, 290
FalI AAGNNNNNCTT 2 cut(s) 105, 137
FatI CATG 1 cut(s) 48
FblI GTMKAC 1 cut(s) 145
FspBI CTAG 2 cut(s) 149, 355
Hin1II CATG 1 cut(s) 52
HindIII AAGCTT 2 cut(s) 201, 327
HinfI GANTC 2 cut(s) 39, 181
Hpy166II GTNNAC 3 cut(s) 8, 146, 265
Hpy188I TCNGA 1 cut(s) 109
Hpy188III TCNNGA 1 cut(s) 235
Hpy8I GTNNAC 3 cut(s) 8, 146, 265
HpyAV CCTTC 1 cut(s) 254
HpyCH4III ACNGT 2 cut(s) 131, 251
HpyCH4IV ACGT 1 cut(s) 96
HpyCH4V TGCA 1 cut(s) 231
HpyF10VI GCNNNNNNNGC 1 cut(s) 118
HpyF3I CTNAG 1 cut(s) 117
HpySE526I ACGT 1 cut(s) 96
Hsp92II CATG 1 cut(s) 52
Kzo9I GATC 5 cut(s) 237, 284, 293, 315, 344
LpnPI CCDG 1 cut(s) 245
LweI GCATC 2 cut(s) 240, 346
MaeI CTAG 2 cut(s) 149, 355
MaeII ACGT 1 cut(s) 96
MaeIII GTNAC 1 cut(s) 92
MalI GATC 5 cut(s) 239, 286, 295, 317, 346
MboI GATC 5 cut(s) 237, 284, 293, 315, 344
MboII GAAGA 1 cut(s) 209
MflI RGATCY 2 cut(s) 237, 293
MluCI AATT 2 cut(s) 15, 307
MlyI GAGTC 1 cut(s) 33
MnlI CCTC 1 cut(s) 92
Mph1103I ATGCAT 1 cut(s) 233
MseI TTAA 1 cut(s) 300
MslI CAYNNNNRTG 2 cut(s) 47, 58
MwoI GCNNNNNNNGC 1 cut(s) 118
NcoI CCATGG 1 cut(s) 48
NdeII GATC 5 cut(s) 237, 284, 293, 315, 344
NlaIII CATG 1 cut(s) 52
NlaIV GGNNCC 2 cut(s) 54, 160
NmeAIII GCCGAG 1 cut(s) 187
NsiI ATGCAT 1 cut(s) 233
OliI CACNNNNGTG 1 cut(s) 58
PfeI GAWTC 1 cut(s) 181
PleI GAGTC 1 cut(s) 33
PpsI GAGTC 1 cut(s) 33
PspN4I GGNNCC 2 cut(s) 54, 160
PspPI GGNCC 1 cut(s) 127
PsuI RGATCY 2 cut(s) 237, 293
RsaI GTAC 1 cut(s) 323
RsaNI GTAC 1 cut(s) 322
RseI CAYNNNNRTG 2 cut(s) 47, 58
SaqAI TTAA 1 cut(s) 300
Sau3AI GATC 5 cut(s) 237, 284, 293, 315, 344
Sau96I GGNCC 1 cut(s) 127
SchI GAGTC 1 cut(s) 33
SetI ASST 7 cut(s) 62, 79, 99, 118, 123, 205, 331
SfaNI GCATC 2 cut(s) 240, 346
SinI GGWCC 1 cut(s) 127
SmiMI CAYNNNNRTG 2 cut(s) 47, 58
SmlI CTYRAG 1 cut(s) 85
SmoI CTYRAG 1 cut(s) 85
SpeI ACTAGT 1 cut(s) 148
Sse9I AATT 2 cut(s) 15, 307
SspMI CTAG 2 cut(s) 149, 355
StyI CCWWGG 2 cut(s) 48, 56
TaaI ACNGT 2 cut(s) 131, 251
TaiI ACGT 1 cut(s) 99
TasI AATT 2 cut(s) 15, 307
TatI WGTACW 1 cut(s) 321
TfiI GAWTC 1 cut(s) 181
Tru1I TTAA 1 cut(s) 300
Tru9I TTAA 1 cut(s) 300
TspDTI ATGAA 1 cut(s) 210
VpaK11BI GGWCC 1 cut(s) 127
XapI RAATTY 1 cut(s) 307
XcmI CCANNNNNNNNNTGG 1 cut(s) 63
XmiI GTMKAC 1 cut(s) 145
XspI CTAG 2 cut(s) 149, 355
Zsp2I ATGCAT 1 cut(s) 233
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.