AT3G45590

Constitutes one of the two catalytic subunit of the tRNA-splicing endonuclease complex, a complex responsible for identification and cleavage of the splice sites in pre-tRNA. It cleaves pre-tRNA at the 5'- and 3'-splice sites to release the intron. The products are an intron and two tRNA half-molecules bearing 2',3'-cyclic phosphate and 5'-OH termini. There are no conserved sequences at the splice sites, but the intron is invariably located at the same site in the gene, placing the splice sites an invariant distance from the constant structural features of the tRNA body. Probably carries the active site for 5'-splice site cleavage (By similarity)

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
3
Physical Location & Seq
Forward (+)
16732540 .. 16733854
1315 bp
Loading structure...
UTR
Exon/CDS
Intron
AT3G45590.2

Sequence Viewer

Length: 714 bp
ATGGCACCAAGGTGGAAATGGAAAGGTGCTGAGGCAAAGGCACTTGCAGAACCTGTTTCGAAAACAGTCTCGGAGCTGAGATCTTCATTGACCCAAACCGAGGCTTTAGGTTTCCTCTCAAGTTGTAACGTACTTTTATCGGTTGAGTCAGAGGAAGCTGAGCTTTTGGATCGTTGTTGTTTTGGTAGACTAGTTGTTGGTGCTGAGAAAGATAAGAGATGGATTCAGTTATCCTTTGAAGAAGCTTTCTTTTTGTTTTACAAACTGAAATGCATCAAGATTTGCCTTCACGGTCGTTCTCTGGAAAACGAGGTAGATTTATGGCGATCCATGAGTTCCTTTAAGCAAGATTTTGCGATCTTGTACAAGGCTTATTCGCATCTACGATCGAAGAACTGGATTGTGAGATCAGGGTTACAATATGGAGTTGATTTCGTGGTGTATAGACATCATCCATCTCTTGTCCACTCTGAATACGCCGTTCTTGTTCAGTCCATTGGCGGGAATGATCGGTTAAAGGTGTGGTCCGATATCCATTGCAGTGTTCGACTAACCGGAAGCGTCGCGAAATCATTGTTGGTTCTTTACGTCAACAGAAAAGTCAACACAGAGAAGATGAATCTGCCTTTGTGTTTAGAGGACTACACAGTTGAAGAGCAAACAATACGTAGATGGAGTCCAGAACTTAGCCGTGAAGATGAAACCAGAACATGA

Protein Analysis

237

Amino Acids

27.36

Weight (kDa)

8.42

Isoelectric Point (pI)

58.46

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
tRNA_int_endo_N PF02778 37 - 108 1.5e-15 tRNA intron endonuclease, N-terminal domain
tRNA_int_endo PF01974 118 - 200 5.3e-19 tRNA intron endonuclease, catalytic C-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 4
AccI GTMKAC 1 cut(s) 187
AccII CGCG 1 cut(s) 566
AciI CCGC 1 cut(s) 501
AclWI GGATC 2 cut(s) 177, 321
AfaI GTAC 2 cut(s) 132, 365
AfiI CCNNNNNNNGG 2 cut(s) 100, 501
AgsI TTSAA 2 cut(s) 239, 653
AhlI ACTAGT 1 cut(s) 190
AjuI GAANNNNNNNTTGG 2 cut(s) 560, 592
AleI CACNNNNGTG 1 cut(s) 10
AluBI AGCT 4 cut(s) 76, 158, 163, 245
AluI AGCT 4 cut(s) 76, 158, 163, 245
Alw26I GTCTC 1 cut(s) 73
AlwI GGATC 2 cut(s) 177, 321
AlwNI CAGNNNCTG 1 cut(s) 53
AspS9I GGNCC 1 cut(s) 525
AsuII TTCGAA 1 cut(s) 59
AvaII GGWCC 1 cut(s) 525
BanI GGYRCC 1 cut(s) 4
BbvCI CCTCAGC 1 cut(s) 30
BccI CCATC 3 cut(s) 213, 463, 666
BceAI ACGGC 2 cut(s) 464, 675
BcoDI GTCTC 1 cut(s) 73
BcuI ACTAGT 1 cut(s) 190
BfaI CTAG 1 cut(s) 191
BglII AGATCT 1 cut(s) 80
BlpI GCTNAGC 1 cut(s) 159
Bme18I GGWCC 1 cut(s) 525
BmgT120I GGNCC 1 cut(s) 525
BmiI GGNNCC 1 cut(s) 6
BmsI GCATC 2 cut(s) 282, 388
Bpu10I CCTNAGC 1 cut(s) 30
Bpu1102I GCTNAGC 1 cut(s) 159
Bpu14I TTCGAA 1 cut(s) 59
BpuEI CTTGAG 1 cut(s) 103
BsaAI YACGTR 1 cut(s) 668
BsaJI CCNNGG 2 cut(s) 8, 99
BsaWI WCCGGW 1 cut(s) 554
Bsc4I CCNNNNNNNGG 2 cut(s) 100, 501
Bse1I ACTGG 1 cut(s) 401
Bse3DI GCAATG 1 cut(s) 535
BseDI CCNNGG 2 cut(s) 8, 99
BseGI GGATG 1 cut(s) 451
BseLI CCNNNNNNNGG 2 cut(s) 100, 501
BseMI GCAATG 1 cut(s) 535
BseMII CTCAG 4 cut(s) 21, 68, 150, 195
BseNI ACTGG 1 cut(s) 401
Bsh1236I CGCG 1 cut(s) 566
Bsh1285I CGRYCG 2 cut(s) 295, 389
BshNI GGYRCC 1 cut(s) 4
BsiEI CGRYCG 2 cut(s) 295, 389
BsiSI CCGG 1 cut(s) 555
BslI CCNNNNNNNGG 2 cut(s) 100, 501
BsmAI GTCTC 1 cut(s) 73
Bsp119I TTCGAA 1 cut(s) 59
Bsp1407I TGTACA 1 cut(s) 363
Bsp143I GATC 7 cut(s) 80, 169, 326, 357, 386, 407, 508
Bsp1720I GCTNAGC 1 cut(s) 159
Bsp68I TCGCGA 1 cut(s) 566
BspACI CCGC 1 cut(s) 501
BspCNI CTCAG 4 cut(s) 22, 69, 151, 196
BspFNI CGCG 1 cut(s) 566
BspLI GGNNCC 1 cut(s) 6
BspPI GGATC 2 cut(s) 177, 321
BspQI GCTCTTC 1 cut(s) 648
BspT104I TTCGAA 1 cut(s) 59
BspT107I GGYRCC 1 cut(s) 4
BsrDI GCAATG 1 cut(s) 535
BsrGI TGTACA 1 cut(s) 363
BsrI ACTGG 1 cut(s) 401
BssECI CCNNGG 2 cut(s) 8, 99
BssMI GATC 7 cut(s) 80, 169, 326, 357, 386, 407, 508
BssT1I CCWWGG 1 cut(s) 8
Bst4CI ACNGT 3 cut(s) 67, 293, 649
Bst6I CTCTTC 1 cut(s) 648
BstAUI TGTACA 1 cut(s) 363
BstBAI YACGTR 1 cut(s) 668
BstBI TTCGAA 1 cut(s) 59
BstDEI CTNAG 5 cut(s) 30, 77, 159, 204, 686
BstF5I GGATG 1 cut(s) 451
BstFNI CGCG 1 cut(s) 566
BstKTI GATC 7 cut(s) 83, 172, 329, 360, 389, 410, 511
BstMAI GTCTC 1 cut(s) 73
BstMBI GATC 7 cut(s) 80, 169, 326, 357, 386, 407, 508
BstMCI CGRYCG 2 cut(s) 295, 389
BstSNI TACGTA 1 cut(s) 668
BstUI CGCG 1 cut(s) 566
BstX2I RGATCY 1 cut(s) 80
BstYI RGATCY 1 cut(s) 80
BtsCI GGATG 1 cut(s) 451
BtsI GCAGTG 1 cut(s) 547
BtsIMutI CAGTG 1 cut(s) 547
BtuMI TCGCGA 1 cut(s) 566
CaiI CAGNNNCTG 1 cut(s) 53
Cfr13I GGNCC 1 cut(s) 525
CseI GACGC 1 cut(s) 550
Csp6I GTAC 2 cut(s) 131, 364
CviAII CATG 2 cut(s) 331, 711
CviJI RGCY 7 cut(s) 76, 104, 158, 163, 245, 371, 690
CviKI_1 RGCY 7 cut(s) 76, 104, 158, 163, 245, 371, 690
CviQI GTAC 2 cut(s) 131, 364
DdeI CTNAG 5 cut(s) 30, 77, 159, 204, 686
DpnI GATC 7 cut(s) 82, 171, 328, 359, 388, 409, 510
DpnII GATC 7 cut(s) 80, 169, 326, 357, 386, 407, 508
Eam1104I CTCTTC 1 cut(s) 648
EarI CTCTTC 1 cut(s) 648
Eco105I TACGTA 1 cut(s) 668
Eco130I CCWWGG 1 cut(s) 8
Eco32I GATATC 1 cut(s) 532
Eco47I GGWCC 1 cut(s) 525
EcoRV GATATC 1 cut(s) 532
EcoT14I CCWWGG 1 cut(s) 8
EcoT22I ATGCAT 1 cut(s) 275
ErhI CCWWGG 1 cut(s) 8
FaeI CATG 2 cut(s) 334, 714
FaiI YATR 5 cut(s) 322, 332, 423, 444, 712
FalI AAGNNNNNCTT 2 cut(s) 147, 179
FatI CATG 2 cut(s) 330, 710
FauI CCCGC 1 cut(s) 494
FblI GTMKAC 1 cut(s) 187
FokI GGATG 1 cut(s) 438
FspBI CTAG 1 cut(s) 191
HapII CCGG 1 cut(s) 555
HgaI GACGC 1 cut(s) 550
Hin1II CATG 2 cut(s) 334, 714
HincII GTYRAC 2 cut(s) 592, 604
HindII GTYRAC 2 cut(s) 592, 604
HindIII AAGCTT 1 cut(s) 243
HinfI GANTC 4 cut(s) 146, 223, 619, 676
HpaII CCGG 1 cut(s) 555
Hpy166II GTNNAC 4 cut(s) 188, 466, 592, 604
Hpy188I TCNGA 4 cut(s) 73, 151, 472, 529
Hpy188III TCNNGA 4 cut(s) 277, 302, 565, 680
Hpy8I GTNNAC 4 cut(s) 188, 466, 592, 604
Hpy99I CGWCG 1 cut(s) 566
HpyAV CCTTC 1 cut(s) 296
HpyCH4III ACNGT 3 cut(s) 67, 293, 649
HpyCH4IV ACGT 3 cut(s) 129, 588, 667
HpyCH4V TGCA 3 cut(s) 47, 273, 540
HpyF3I CTNAG 5 cut(s) 30, 77, 159, 204, 686
HpySE526I ACGT 3 cut(s) 129, 588, 667
Hsp92II CATG 2 cut(s) 334, 714
Kzo9I GATC 7 cut(s) 80, 169, 326, 357, 386, 407, 508
LguI GCTCTTC 1 cut(s) 648
LmnI GCTCC 1 cut(s) 73
LpnPI CCDG 6 cut(s) 66, 287, 382, 396, 568, 693
LweI GCATC 2 cut(s) 282, 388
MaeI CTAG 1 cut(s) 191
MaeII ACGT 3 cut(s) 129, 588, 667
MaeIII GTNAC 2 cut(s) 125, 414
MalI GATC 7 cut(s) 82, 171, 328, 359, 388, 409, 510
MboI GATC 7 cut(s) 80, 169, 326, 357, 386, 407, 508
MboII GAAGA 6 cut(s) 75, 251, 403, 625, 665, 707
MflI RGATCY 1 cut(s) 80
MlyI GAGTC 2 cut(s) 155, 685
MnlI CCTC 6 cut(s) 25, 94, 125, 145, 304, 631
Mph1103I ATGCAT 1 cut(s) 275
MseI TTAA 2 cut(s) 342, 515
MslI CAYNNNNRTG 2 cut(s) 10, 540
MspI CCGG 1 cut(s) 555
MvnI CGCG 1 cut(s) 566
NdeII GATC 7 cut(s) 80, 169, 326, 357, 386, 407, 508
NlaIII CATG 2 cut(s) 334, 714
NlaIV GGNNCC 1 cut(s) 6
NruI TCGCGA 1 cut(s) 566
NsiI ATGCAT 1 cut(s) 275
NspV TTCGAA 1 cut(s) 59
OliI CACNNNNGTG 1 cut(s) 10
PciSI GCTCTTC 1 cut(s) 648
PfeI GAWTC 2 cut(s) 223, 619
Ple19I CGATCG 1 cut(s) 389
PleI GAGTC 2 cut(s) 154, 684
PpsI GAGTC 2 cut(s) 154, 684
Ppu21I YACGTR 1 cut(s) 668
PspN4I GGNNCC 1 cut(s) 6
PspPI GGNCC 1 cut(s) 525
PstNI CAGNNNCTG 1 cut(s) 53
PsuI RGATCY 1 cut(s) 80
PvuI CGATCG 1 cut(s) 389
RruI TCGCGA 1 cut(s) 566
RsaI GTAC 2 cut(s) 132, 365
RsaNI GTAC 2 cut(s) 131, 364
RseI CAYNNNNRTG 2 cut(s) 10, 540
SapI GCTCTTC 1 cut(s) 648
SaqAI TTAA 2 cut(s) 342, 515
Sau3AI GATC 7 cut(s) 80, 169, 326, 357, 386, 407, 508
Sau96I GGNCC 1 cut(s) 525
SchI GAGTC 2 cut(s) 155, 685
SfaNI GCATC 2 cut(s) 282, 388
SfuI TTCGAA 1 cut(s) 59
SinI GGWCC 1 cut(s) 525
SmiMI CAYNNNNRTG 2 cut(s) 10, 540
SmlI CTYRAG 1 cut(s) 118
SmoI CTYRAG 1 cut(s) 118
SnaBI TACGTA 1 cut(s) 668
SpeI ACTAGT 1 cut(s) 190
SsiI CCGC 1 cut(s) 501
SspMI CTAG 1 cut(s) 191
StyI CCWWGG 1 cut(s) 8
TaaI ACNGT 3 cut(s) 67, 293, 649
TaiI ACGT 3 cut(s) 132, 591, 670
TaqI TCGA 3 cut(s) 59, 389, 547
TatI WGTACW 1 cut(s) 363
TfiI GAWTC 2 cut(s) 223, 619
Tru1I TTAA 2 cut(s) 342, 515
Tru9I TTAA 2 cut(s) 342, 515
TscAI CASTG 1 cut(s) 547
TspDTI ATGAA 3 cut(s) 75, 632, 714
TspRI CASTG 1 cut(s) 547
VpaK11BI GGWCC 1 cut(s) 525
XcmI CCANNNNNNNNNTGG 1 cut(s) 15
XmiI GTMKAC 1 cut(s) 187
XspI CTAG 1 cut(s) 191
Zsp2I ATGCAT 1 cut(s) 275
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.