AT5G60230

Constitutes one of the two catalytic subunit of the tRNA-splicing endonuclease complex, a complex responsible for identification and cleavage of the splice sites in pre-tRNA. It cleaves pre-tRNA at the 5'- and 3'-splice sites to release the intron. The products are an intron and two tRNA half-molecules bearing 2',3'-cyclic phosphate and 5'-OH termini. There are no conserved sequences at the splice sites, but the intron is invariably located at the same site in the gene, placing the splice sites an invariant distance from the constant structural features of the tRNA body. Probably carries the active site for 5'-splice site cleavage (By similarity)

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
Physical Location & Seq
Reverse (-)
24250008 .. 24251613
1606 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G60230.1

Sequence Viewer

Length: 753 bp
ATGGCGCCTAGATGGAAATGGAAAGGAGCTGAAGCAAAAGCTCTTGCAGAACCTATTTCAAAATCAGTCTCAGAGCTCCAGCTCTCTCTAGCCGAAACAGAGTCCTCGGGAACCCTCTCAAGTTGCAATGTGCTTCTAGCGGTTGAGCCAGAGCAAGCTGAGCTTCTTGACCGTTGTTGTTTTGGCAGACTCGTTCTATCGGCAGAGAAAATCAAGAAATGGATTCAGTTATCTTTTGAAGAAGCTTTCTTTTTGCATTACAATCTCAAATGCATCAAAATCTCACTTCAAGGTCGTTGCTTGGAGAATGAAGTAGACACATGGCTCTACATGAAATCAAAAAGACCAAACTTTCCAATGTTTTTCAAAGCTTATTCACATTTACGATCGAAGAACTGGGTTTTGAGATCAGGGTTGCAATACGGTGTGGATTTTGTGGCATACCGTCACCATCCATCTCTTGTCCACTCTGAATACTCGGTTTTAGTTCAGTCTGGTGACAGTGATCGGTTAAGAGTGTGGTCAGATATCCATTGTGCTGTTAGGTTAAGCGGAAGTGTTGCGAAAACGTTGTTGACTCTCTACGTTAATGGTAACTTCAAAGGAGAGGATGTGAATCTACTTGTATGTTTGGAGAACTTCACAGTGGAAGAACAAACGATAAGTAGATGGAGCCCAGAACTCAGTCGTGAAGATCAATCCACAAATTCAAAACAACATGTTCCCAACGTGAGTAATTTGAACACTCTTTGA

Protein Analysis

250

Amino Acids

28.52

Weight (kDa)

7.61

Isoelectric Point (pI)

45.48

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
tRNA_int_endo_N PF02778 36 - 106 5.2e-15 tRNA intron endonuclease, N-terminal domain
tRNA_int_endo PF01974 122 - 198 1.6e-17 tRNA intron endonuclease, catalytic C-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 4
AccI GTMKAC 1 cut(s) 315
AciI CCGC 2 cut(s) 140, 552
AclI AACGTT 1 cut(s) 569
AcsI RAATTY 1 cut(s) 706
AcuI CTGAAG 1 cut(s) 51
AcyI GRCGYC 1 cut(s) 5
AflIII ACRYGT 1 cut(s) 718
AgsI TTSAA 7 cut(s) 60, 239, 290, 367, 601, 711, 742
AluBI AGCT 8 cut(s) 29, 41, 76, 82, 158, 163, 245, 371
AluI AGCT 8 cut(s) 29, 41, 76, 82, 158, 163, 245, 371
Alw21I GWGCWC 1 cut(s) 78
Alw26I GTCTC 1 cut(s) 73
Ama87I CYCGRG 1 cut(s) 106
ApoI RAATTY 1 cut(s) 706
AspLEI GCGC 1 cut(s) 7
AsuHPI GGTGA 2 cut(s) 440, 509
AvaI CYCGRG 1 cut(s) 106
BanI GGYRCC 1 cut(s) 4
BanII GRGCYC 2 cut(s) 78, 677
Bbv12I GWGCWC 1 cut(s) 78
BccI CCATC 4 cut(s) 6, 459, 463, 663
BcoDI GTCTC 1 cut(s) 73
BfaI CTAG 3 cut(s) 9, 89, 137
BfoI RGCGCY 1 cut(s) 8
BlpI GCTNAGC 1 cut(s) 159
BmeT110I CYCGRG 1 cut(s) 106
BmiI GGNNCC 3 cut(s) 6, 112, 674
BmrI ACTGGG 1 cut(s) 406
BmsI GCATC 1 cut(s) 282
BmuI ACTGGG 1 cut(s) 406
BpmI CTGGAG 1 cut(s) 62
Bpu1102I GCTNAGC 1 cut(s) 159
BpuEI CTTGAG 1 cut(s) 103
BsaBI GATNNNNATC 1 cut(s) 615
BsaHI GRCGYC 1 cut(s) 5
BsaJI CCNNGG 1 cut(s) 105
BsaXI ACNNNNNCTCC 2 cut(s) 597, 627
Bse1I ACTGG 1 cut(s) 401
Bse3DI GCAATG 1 cut(s) 133
Bse8I GATNNNNATC 1 cut(s) 615
BseDI CCNNGG 1 cut(s) 105
BseGI GGATG 2 cut(s) 451, 616
BseJI GATNNNNATC 1 cut(s) 615
BseMI GCAATG 1 cut(s) 133
BseMII CTCAG 3 cut(s) 84, 150, 697
BseNI ACTGG 1 cut(s) 401
Bsh1285I CGRYCG 1 cut(s) 389
BshNI GGYRCC 1 cut(s) 4
BsiEI CGRYCG 1 cut(s) 389
BsiHKAI GWGCWC 1 cut(s) 78
BsiHKCI CYCGRG 1 cut(s) 106
BsmAI GTCTC 1 cut(s) 73
BsoBI CYCGRG 1 cut(s) 106
Bsp1286I GDGCHC 2 cut(s) 78, 677
Bsp143I GATC 4 cut(s) 386, 407, 505, 694
Bsp1720I GCTNAGC 1 cut(s) 159
BspACI CCGC 2 cut(s) 140, 552
BspCNI CTCAG 3 cut(s) 83, 151, 696
BspLI GGNNCC 3 cut(s) 6, 112, 674
BspT107I GGYRCC 1 cut(s) 4
BsrDI GCAATG 1 cut(s) 133
BsrI ACTGG 1 cut(s) 401
BssECI CCNNGG 1 cut(s) 105
BssMI GATC 4 cut(s) 386, 407, 505, 694
BssNI GRCGYC 1 cut(s) 5
Bst4CI ACNGT 5 cut(s) 173, 425, 446, 503, 646
BstACI GRCGYC 1 cut(s) 5
BstC8I GCNNGC 1 cut(s) 156
BstDEI CTNAG 3 cut(s) 70, 159, 683
BstF5I GGATG 2 cut(s) 451, 616
BstH2I RGCGCY 1 cut(s) 8
BstHHI GCGC 1 cut(s) 7
BstKTI GATC 4 cut(s) 389, 410, 508, 697
BstMAI GTCTC 1 cut(s) 73
BstMBI GATC 4 cut(s) 386, 407, 505, 694
BstMCI CGRYCG 1 cut(s) 389
BstMWI GCNNNNNNNGC 1 cut(s) 160
BstNSI RCATGY 1 cut(s) 722
BtsCI GGATG 2 cut(s) 451, 616
BtsIMutI CAGTG 2 cut(s) 508, 651
Cac8I GCNNGC 1 cut(s) 156
CfoI GCGC 1 cut(s) 7
CviAII CATG 3 cut(s) 321, 331, 719
DdeI CTNAG 3 cut(s) 70, 159, 683
DinI GGCGCC 1 cut(s) 6
DpnI GATC 4 cut(s) 388, 409, 507, 696
DpnII GATC 4 cut(s) 386, 407, 505, 694
Ecl136II GAGCTC 1 cut(s) 76
Eco24I GRGCYC 2 cut(s) 78, 677
Eco32I GATATC 1 cut(s) 529
Eco53kI GAGCTC 1 cut(s) 76
Eco57I CTGAAG 1 cut(s) 51
Eco88I CYCGRG 1 cut(s) 106
EcoICRI GAGCTC 1 cut(s) 76
EcoRV GATATC 1 cut(s) 529
EcoT22I ATGCAT 1 cut(s) 275
EcoT38I GRGCYC 2 cut(s) 78, 677
EgeI GGCGCC 1 cut(s) 6
EheI GGCGCC 1 cut(s) 6
FaeI CATG 3 cut(s) 324, 334, 722
FaiI YATR 5 cut(s) 322, 332, 442, 628, 720
FalI AAGNNNNNCTT 2 cut(s) 147, 179
FatI CATG 3 cut(s) 320, 330, 718
FblI GTMKAC 1 cut(s) 315
FokI GGATG 2 cut(s) 438, 623
FriOI GRGCYC 2 cut(s) 78, 677
FspBI CTAG 3 cut(s) 9, 89, 137
GlaI GCGC 1 cut(s) 6
GsuI CTGGAG 1 cut(s) 62
HaeII RGCGCY 1 cut(s) 8
HhaI GCGC 1 cut(s) 7
Hin1I GRCGYC 1 cut(s) 5
Hin1II CATG 3 cut(s) 324, 334, 722
Hin6I GCGC 1 cut(s) 5
HinP1I GCGC 1 cut(s) 5
HincII GTYRAC 1 cut(s) 576
HindII GTYRAC 1 cut(s) 576
HindIII AAGCTT 2 cut(s) 243, 369
HinfI GANTC 5 cut(s) 101, 189, 223, 577, 616
HphI GGTGA 2 cut(s) 440, 509
Hpy166II GTNNAC 3 cut(s) 316, 466, 576
Hpy188I TCNGA 3 cut(s) 73, 472, 526
Hpy188III TCNNGA 4 cut(s) 108, 167, 214, 689
Hpy8I GTNNAC 3 cut(s) 316, 466, 576
HpyCH4III ACNGT 5 cut(s) 173, 425, 446, 503, 646
HpyCH4IV ACGT 3 cut(s) 569, 585, 729
HpyCH4V TGCA 5 cut(s) 47, 126, 256, 273, 418
HpyF10VI GCNNNNNNNGC 1 cut(s) 160
HpyF3I CTNAG 3 cut(s) 70, 159, 683
HpySE526I ACGT 3 cut(s) 569, 585, 729
Hsp92I GRCGYC 1 cut(s) 5
Hsp92II CATG 3 cut(s) 324, 334, 722
HspAI GCGC 1 cut(s) 5
KasI GGCGCC 1 cut(s) 4
Kzo9I GATC 4 cut(s) 386, 407, 505, 694
LmnI GCTCC 3 cut(s) 26, 81, 672
LpnPI CCDG 6 cut(s) 92, 162, 382, 396, 480, 690
LweI GCATC 1 cut(s) 282
MaeI CTAG 3 cut(s) 9, 89, 137
MaeII ACGT 3 cut(s) 569, 585, 729
MaeIII GTNAC 3 cut(s) 446, 497, 593
MalI GATC 4 cut(s) 388, 409, 507, 696
MboI GATC 4 cut(s) 386, 407, 505, 694
MboII GAAGA 4 cut(s) 251, 403, 662, 704
MhlI GDGCHC 2 cut(s) 78, 677
MluCI AATT 2 cut(s) 706, 736
Mly113I GGCGCC 1 cut(s) 5
MlyI GAGTC 3 cut(s) 110, 183, 571
MnlI CCTC 3 cut(s) 115, 125, 601
Mph1103I ATGCAT 1 cut(s) 275
MseI TTAA 3 cut(s) 512, 548, 588
MwoI GCNNNNNNNGC 1 cut(s) 160
NarI GGCGCC 1 cut(s) 5
NdeII GATC 4 cut(s) 386, 407, 505, 694
NlaIII CATG 3 cut(s) 324, 334, 722
NlaIV GGNNCC 3 cut(s) 6, 112, 674
NmuCI GTSAC 2 cut(s) 446, 497
NsiI ATGCAT 1 cut(s) 275
NspI RCATGY 1 cut(s) 722
PciI ACATGT 1 cut(s) 718
PfeI GAWTC 2 cut(s) 223, 616
Ple19I CGATCG 1 cut(s) 389
PleI GAGTC 3 cut(s) 109, 183, 571
PluTI GGCGCC 1 cut(s) 8
PpsI GAGTC 3 cut(s) 109, 183, 571
PscI ACATGT 1 cut(s) 718
Psp124BI GAGCTC 1 cut(s) 78
Psp1406I AACGTT 1 cut(s) 569
PspN4I GGNNCC 3 cut(s) 6, 112, 674
PvuI CGATCG 1 cut(s) 389
SacI GAGCTC 1 cut(s) 78
SaqAI TTAA 3 cut(s) 512, 548, 588
Sau3AI GATC 4 cut(s) 386, 407, 505, 694
SchI GAGTC 3 cut(s) 110, 183, 571
SduI GDGCHC 2 cut(s) 78, 677
SfaNI GCATC 1 cut(s) 282
SfoI GGCGCC 1 cut(s) 6
SmlI CTYRAG 1 cut(s) 118
SmoI CTYRAG 1 cut(s) 118
Sse9I AATT 2 cut(s) 706, 736
SsiI CCGC 2 cut(s) 140, 552
SspDI GGCGCC 1 cut(s) 4
SspMI CTAG 3 cut(s) 9, 89, 137
SstI GAGCTC 1 cut(s) 78
TaaI ACNGT 5 cut(s) 173, 425, 446, 503, 646
TaiI ACGT 3 cut(s) 572, 588, 732
TaqI TCGA 1 cut(s) 389
TasI AATT 2 cut(s) 706, 736
TfiI GAWTC 2 cut(s) 223, 616
Tru1I TTAA 3 cut(s) 512, 548, 588
Tru9I TTAA 3 cut(s) 512, 548, 588
TscAI CASTG 2 cut(s) 508, 651
TseFI GTSAC 2 cut(s) 446, 497
Tsp45I GTSAC 2 cut(s) 446, 497
TspDTI ATGAA 2 cut(s) 324, 347
TspRI CASTG 2 cut(s) 508, 651
XapI RAATTY 1 cut(s) 706
XceI RCATGY 1 cut(s) 722
XmiI GTMKAC 1 cut(s) 315
XspI CTAG 3 cut(s) 9, 89, 137
Zsp2I ATGCAT 1 cut(s) 275
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.