AT5G03050

No description available

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
5
Physical Location & Seq
Reverse (-)
713227 .. 716390
3164 bp
Loading structure...
UTR
Exon/CDS
Intron
AT5G03050.1

Sequence Viewer

Length: 423 bp
ATGAACACTGAAATGGAAGAAGACGCAGGGAATGGAGGATTTCGGAAACGCATGAGAGCATCTGATGAAGAGGGAAAAGGAGATTCGAGAGATGGAATTAGCCTTGATCATACCATTGAGAATGAAGAAGCTGAGACGAAACTTGTTGCTTCTGATGAGATGGAACTTAGCATTGCGCAAATTCTCGATAAGATTGAGAGCTTCACACAAACTGTTTCTAACTTGCTGGAAACAGGGAAAACAATGCTCAAGGAACTCAGTAACGAATTCGAAGAACGCTTGATCATGATACACAAGGAACATGTTGAGAAATGGCAGGACGAGATCAAGGAGTTGCGTTTGCTTGATGCATCAAACGAGGAGACTACTTCCCTCTTACACAACGCTCGCTATCTGATTCAGAATCCTAGCATTGAGCAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

140

Amino Acids

16.07

Weight (kDa)

4.54

Isoelectric Point (pI)

42.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 177
AcsI RAATTY 2 cut(s) 180, 266
AflIII ACRYGT 1 cut(s) 301
AluBI AGCT 2 cut(s) 131, 201
AluI AGCT 2 cut(s) 131, 201
Alw26I GTCTC 2 cut(s) 128, 356
ApoI RAATTY 2 cut(s) 180, 266
AspLEI GCGC 1 cut(s) 178
AsuII TTCGAA 1 cut(s) 270
BbsI GAAGAC 1 cut(s) 27
BccI CCATC 2 cut(s) 86, 154
BclI TGATCA 2 cut(s) 106, 282
BcoDI GTCTC 2 cut(s) 128, 356
BfaI CTAG 1 cut(s) 408
BmsI GCATC 3 cut(s) 68, 337, 359
BpiI GAAGAC 1 cut(s) 27
Bpu14I TTCGAA 1 cut(s) 270
BpuEI CTTGAG 1 cut(s) 233
Bse3DI GCAATG 1 cut(s) 171
BseMI GCAATG 1 cut(s) 171
BseMII CTCAG 2 cut(s) 123, 271
BseRI GAGGAG 1 cut(s) 374
BsmAI GTCTC 2 cut(s) 128, 356
BsmBI CGTCTC 1 cut(s) 128
Bsp119I TTCGAA 1 cut(s) 270
Bsp143I GATC 3 cut(s) 106, 282, 324
BspCNI CTCAG 2 cut(s) 124, 270
BspHI TCATGA 1 cut(s) 285
BspT104I TTCGAA 1 cut(s) 270
BsrDI GCAATG 1 cut(s) 171
BssMI GATC 3 cut(s) 106, 282, 324
Bst4CI ACNGT 1 cut(s) 214
Bst6I CTCTTC 1 cut(s) 63
BstBI TTCGAA 1 cut(s) 270
BstC8I GCNNGC 1 cut(s) 388
BstDEI CTNAG 3 cut(s) 132, 167, 257
BstHHI GCGC 1 cut(s) 178
BstKTI GATC 3 cut(s) 109, 285, 327
BstMAI GTCTC 2 cut(s) 128, 356
BstMBI GATC 3 cut(s) 106, 282, 324
BstNSI RCATGY 1 cut(s) 305
BstV2I GAAGAC 1 cut(s) 27
BtsIMutI CAGTG 1 cut(s) 6
Cac8I GCNNGC 1 cut(s) 388
CciI TCATGA 1 cut(s) 285
CfoI GCGC 1 cut(s) 178
CseI GACGC 1 cut(s) 32
CviAII CATG 3 cut(s) 52, 286, 302
CviJI RGCY 3 cut(s) 102, 131, 201
CviKI_1 RGCY 3 cut(s) 102, 131, 201
DdeI CTNAG 3 cut(s) 132, 167, 257
DpnI GATC 3 cut(s) 108, 284, 326
DpnII GATC 3 cut(s) 106, 282, 324
Eam1104I CTCTTC 1 cut(s) 63
EarI CTCTTC 1 cut(s) 63
EcoRI GAATTC 1 cut(s) 266
EcoT22I ATGCAT 1 cut(s) 352
Esp3I CGTCTC 1 cut(s) 128
FaeI CATG 3 cut(s) 55, 289, 305
FaiI YATR 4 cut(s) 53, 111, 287, 303
FatI CATG 3 cut(s) 51, 285, 301
FbaI TGATCA 2 cut(s) 106, 282
FspBI CTAG 1 cut(s) 408
FspI TGCGCA 1 cut(s) 177
GlaI GCGC 1 cut(s) 177
HgaI GACGC 1 cut(s) 32
HhaI GCGC 1 cut(s) 178
Hin1II CATG 3 cut(s) 55, 289, 305
Hin6I GCGC 1 cut(s) 176
HinP1I GCGC 1 cut(s) 176
HinfI GANTC 3 cut(s) 83, 397, 403
Hpy188I TCNGA 5 cut(s) 45, 64, 154, 396, 402
Hpy188III TCNNGA 3 cut(s) 87, 185, 286
HpyCH4III ACNGT 1 cut(s) 214
HpyCH4V TGCA 1 cut(s) 350
HpyF3I CTNAG 3 cut(s) 132, 167, 257
Hsp92II CATG 3 cut(s) 55, 289, 305
HspAI GCGC 1 cut(s) 176
Ksp22I TGATCA 2 cut(s) 106, 282
Kzo9I GATC 3 cut(s) 106, 282, 324
LpnPI CCDG 4 cut(s) 12, 212, 219, 302
LweI GCATC 3 cut(s) 68, 337, 359
MaeI CTAG 1 cut(s) 408
MaeIII GTNAC 1 cut(s) 260
MalI GATC 3 cut(s) 108, 284, 326
MboI GATC 3 cut(s) 106, 282, 324
MboII GAAGA 5 cut(s) 29, 32, 80, 137, 284
MluCI AATT 3 cut(s) 96, 180, 266
MnlI CCTC 4 cut(s) 29, 64, 352, 383
Mph1103I ATGCAT 1 cut(s) 352
MslI CAYNNNNRTG 1 cut(s) 11
NdeII GATC 3 cut(s) 106, 282, 324
NlaIII CATG 3 cut(s) 55, 289, 305
NsbI TGCGCA 1 cut(s) 177
NsiI ATGCAT 1 cut(s) 352
NspI RCATGY 1 cut(s) 305
NspV TTCGAA 1 cut(s) 270
PagI TCATGA 1 cut(s) 285
PciI ACATGT 1 cut(s) 301
PfeI GAWTC 3 cut(s) 83, 397, 403
PscI ACATGT 1 cut(s) 301
RseI CAYNNNNRTG 1 cut(s) 11
Sau3AI GATC 3 cut(s) 106, 282, 324
SetI ASST 2 cut(s) 133, 203
SfaNI GCATC 3 cut(s) 68, 337, 359
SfuI TTCGAA 1 cut(s) 270
SmiMI CAYNNNNRTG 1 cut(s) 11
SmlI CTYRAG 1 cut(s) 248
SmoI CTYRAG 1 cut(s) 248
Sse9I AATT 3 cut(s) 96, 180, 266
SspMI CTAG 1 cut(s) 408
TaaI ACNGT 1 cut(s) 214
TaqI TCGA 3 cut(s) 86, 186, 270
TasI AATT 3 cut(s) 96, 180, 266
TfiI GAWTC 3 cut(s) 83, 397, 403
TscAI CASTG 1 cut(s) 13
TspDTI ATGAA 3 cut(s) 17, 81, 138
TspRI CASTG 1 cut(s) 13
XapI RAATTY 2 cut(s) 180, 266
XceI RCATGY 1 cut(s) 305
XspI CTAG 1 cut(s) 408
Zsp2I ATGCAT 1 cut(s) 352
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.