Rmu_sc0015777.1_g000003

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0015777.1
OG0002939
Physical Location & Seq
Reverse (-)
16068 .. 16450
383 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0015777.1_g000003.1.cds

Sequence Viewer

Length: 297 bp
atgagcttcaacaaaaactccaaagagaggttcgttgaattaggcatagatttttgtgcagataaggtgtttgatgagatgcttgtgagaaatagtagtgactgtgattgtagattgaatctgattcacaaggagcaattggagaaatggcaggaggagatcagagagttgcgcgcgattgatgcttcgaatgaggaggctagtgctattgacaggacccgccccagatttcaccccgaaattcgaagagaccctgtggggcccaccttaaaagaaattctaccaaaaatttggtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

98

Amino Acids

11.62

Weight (kDa)

5.43

Isoelectric Point (pI)

52.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 2 cut(s) 174, 176
AciI CCGC 1 cut(s) 220
AcsI RAATTY 3 cut(s) 240, 276, 288
AfiI CCNNNNNNNGG 1 cut(s) 27
AgsI TTSAA 3 cut(s) 10, 38, 118
AjuI GAANNNNNNNTTGG 2 cut(s) 14, 46
AluBI AGCT 1 cut(s) 6
AluI AGCT 1 cut(s) 6
Alw26I GTCTC 1 cut(s) 243
AoxI GGCC 1 cut(s) 260
ApaI GGGCCC 1 cut(s) 264
ApoI RAATTY 3 cut(s) 240, 276, 288
AspLEI GCGC 2 cut(s) 174, 176
AspS9I GGNCC 3 cut(s) 216, 260, 261
AsuHPI GGTGA 1 cut(s) 224
AsuII TTCGAA 2 cut(s) 188, 244
AvaII GGWCC 1 cut(s) 216
BaeGI GKGCMC 1 cut(s) 264
BanII GRGCYC 1 cut(s) 264
BcoDI GTCTC 1 cut(s) 243
BfaI CTAG 1 cut(s) 201
Bme18I GGWCC 1 cut(s) 216
BmgT120I GGNCC 3 cut(s) 216, 260, 261
BmiI GGNNCC 3 cut(s) 218, 261, 262
BmsI GCATC 2 cut(s) 69, 172
Bpu14I TTCGAA 2 cut(s) 188, 244
BsaI GGTCTC 1 cut(s) 243
BsaXI ACNNNNNCTCC 1 cut(s) 32
Bsc4I CCNNNNNNNGG 1 cut(s) 27
BseLI CCNNNNNNNGG 1 cut(s) 27
BsePI GCGCGC 1 cut(s) 172
BseRI GAGGAG 2 cut(s) 170, 209
BseSI GKGCMC 1 cut(s) 264
BsgI GTGCAG 1 cut(s) 78
Bsh1236I CGCG 2 cut(s) 174, 176
BshFI GGCC 1 cut(s) 262
BslI CCNNNNNNNGG 1 cut(s) 27
BsmAI GTCTC 1 cut(s) 243
BsnI GGCC 1 cut(s) 262
Bso31I GGTCTC 1 cut(s) 243
Bsp119I TTCGAA 2 cut(s) 188, 244
Bsp120I GGGCCC 1 cut(s) 260
Bsp1286I GDGCHC 1 cut(s) 264
Bsp143I GATC 1 cut(s) 159
BspACI CCGC 1 cut(s) 220
BspANI GGCC 1 cut(s) 262
BspFNI CGCG 2 cut(s) 174, 176
BspLI GGNNCC 3 cut(s) 218, 261, 262
BspT104I TTCGAA 2 cut(s) 188, 244
BspTNI GGTCTC 1 cut(s) 243
BssHII GCGCGC 1 cut(s) 172
BssMI GATC 1 cut(s) 159
Bst4CI ACNGT 1 cut(s) 104
Bst6I CTCTTC 1 cut(s) 241
BstBI TTCGAA 2 cut(s) 188, 244
BstC8I GCNNGC 1 cut(s) 174
BstFNI CGCG 2 cut(s) 174, 176
BstHHI GCGC 2 cut(s) 174, 176
BstKTI GATC 1 cut(s) 162
BstMAI GTCTC 1 cut(s) 243
BstMBI GATC 1 cut(s) 159
BstMWI GCNNNNNNNGC 1 cut(s) 182
BstSLI GKGCMC 1 cut(s) 264
BstUI CGCG 2 cut(s) 174, 176
BstXI CCANNNNNNTGG 1 cut(s) 291
BsuRI GGCC 1 cut(s) 262
Cac8I GCNNGC 1 cut(s) 174
CfoI GCGC 2 cut(s) 174, 176
Cfr13I GGNCC 3 cut(s) 216, 260, 261
CviJI RGCY 3 cut(s) 6, 200, 262
CviKI_1 RGCY 3 cut(s) 6, 200, 262
DpnI GATC 1 cut(s) 161
DpnII GATC 1 cut(s) 159
Eam1104I CTCTTC 1 cut(s) 241
EarI CTCTTC 1 cut(s) 241
Eco24I GRGCYC 1 cut(s) 264
Eco31I GGTCTC 1 cut(s) 243
Eco47I GGWCC 1 cut(s) 216
EcoO109I RGGNCCY 2 cut(s) 216, 260
EcoT38I GRGCYC 1 cut(s) 264
FaiI YATR 1 cut(s) 47
FauI CCCGC 1 cut(s) 227
FriOI GRGCYC 1 cut(s) 264
FspBI CTAG 1 cut(s) 201
GlaI GCGC 2 cut(s) 173, 175
HaeIII GGCC 1 cut(s) 262
HhaI GCGC 2 cut(s) 174, 176
Hin6I GCGC 2 cut(s) 172, 174
HinP1I GCGC 2 cut(s) 172, 174
HinfI GANTC 2 cut(s) 118, 124
HphI GGTGA 1 cut(s) 224
Hpy188I TCNGA 2 cut(s) 123, 164
HpyCH4III ACNGT 1 cut(s) 104
HpyCH4V TGCA 1 cut(s) 59
HpyF10VI GCNNNNNNNGC 1 cut(s) 182
HspAI GCGC 2 cut(s) 172, 174
Kzo9I GATC 1 cut(s) 159
LmnI GCTCC 1 cut(s) 133
LpnPI CCDG 4 cut(s) 137, 199, 238, 267
LweI GCATC 2 cut(s) 69, 172
MaeI CTAG 1 cut(s) 201
MaeIII GTNAC 1 cut(s) 98
MalI GATC 1 cut(s) 161
MboI GATC 1 cut(s) 159
MboII GAAGA 1 cut(s) 258
MfeI CAATTG 1 cut(s) 137
MhlI GDGCHC 1 cut(s) 264
MluCI AATT 5 cut(s) 38, 137, 240, 276, 288
MnlI CCTC 4 cut(s) 21, 148, 187, 190
MseI TTAA 1 cut(s) 269
MunI CAATTG 1 cut(s) 137
MvnI CGCG 2 cut(s) 174, 176
MwoI GCNNNNNNNGC 1 cut(s) 182
NdeII GATC 1 cut(s) 159
NlaIV GGNNCC 3 cut(s) 218, 261, 262
NmuCI GTSAC 1 cut(s) 98
NspV TTCGAA 2 cut(s) 188, 244
PauI GCGCGC 1 cut(s) 172
PfeI GAWTC 2 cut(s) 118, 124
PpuMI RGGWCCY 1 cut(s) 216
Psp5II RGGWCCY 1 cut(s) 216
PspN4I GGNNCC 3 cut(s) 218, 261, 262
PspOMI GGGCCC 1 cut(s) 260
PspPI GGNCC 3 cut(s) 216, 260, 261
PspPPI RGGWCCY 1 cut(s) 216
PteI GCGCGC 1 cut(s) 172
SaqAI TTAA 1 cut(s) 269
Sau3AI GATC 1 cut(s) 159
Sau96I GGNCC 3 cut(s) 216, 260, 261
SduI GDGCHC 1 cut(s) 264
SetI ASST 4 cut(s) 8, 32, 69, 269
SfaNI GCATC 2 cut(s) 69, 172
SfuI TTCGAA 2 cut(s) 188, 244
SinI GGWCC 1 cut(s) 216
Sse9I AATT 5 cut(s) 38, 137, 240, 276, 288
SsiI CCGC 1 cut(s) 220
SspMI CTAG 1 cut(s) 201
TaaI ACNGT 1 cut(s) 104
TaqI TCGA 2 cut(s) 188, 244
TasI AATT 5 cut(s) 38, 137, 240, 276, 288
TfiI GAWTC 2 cut(s) 118, 124
Tru1I TTAA 1 cut(s) 269
Tru9I TTAA 1 cut(s) 269
TseFI GTSAC 1 cut(s) 98
Tsp45I GTSAC 1 cut(s) 98
VpaK11BI GGWCC 1 cut(s) 216
XapI RAATTY 3 cut(s) 240, 276, 288
XspI CTAG 1 cut(s) 201
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.