Rh5DG523500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Forward (+)
81197311 .. 81197654
344 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG523500.1

Sequence Viewer

Length: 165 bp
ATGAGCTCCGACAAAAACTCCAAAGAGAGGATTCACAAGGAGGAAATGGAGAAATGGCAGGATGAGATCAGAGAGTTGCGCGCGATTGATGCTTCGAATGAGGAGGCTAGTGCTGTGTTGCATGATGCTACATATTTGTTTCAGAATCCTCATGTTGATTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

54

Amino Acids

6.33

Weight (kDa)

4.81

Isoelectric Point (pI)

49.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 2 cut(s) 81, 83
AfiI CCNNNNNNNGG 1 cut(s) 27
AluBI AGCT 1 cut(s) 6
AluI AGCT 1 cut(s) 6
Alw21I GWGCWC 1 cut(s) 8
AspLEI GCGC 2 cut(s) 81, 83
AsuII TTCGAA 1 cut(s) 95
BanII GRGCYC 1 cut(s) 8
Bbv12I GWGCWC 1 cut(s) 8
BfaI CTAG 1 cut(s) 108
BmsI GCATC 2 cut(s) 79, 115
Bpu14I TTCGAA 1 cut(s) 95
BsaXI ACNNNNNCTCC 1 cut(s) 32
Bsc4I CCNNNNNNNGG 1 cut(s) 27
BseGI GGATG 1 cut(s) 67
BseLI CCNNNNNNNGG 1 cut(s) 27
BsePI GCGCGC 1 cut(s) 79
BseRI GAGGAG 1 cut(s) 116
Bsh1236I CGCG 2 cut(s) 81, 83
BsiHKAI GWGCWC 1 cut(s) 8
BslI CCNNNNNNNGG 1 cut(s) 27
Bsp119I TTCGAA 1 cut(s) 95
Bsp1286I GDGCHC 1 cut(s) 8
Bsp143I GATC 1 cut(s) 66
BspFNI CGCG 2 cut(s) 81, 83
BspT104I TTCGAA 1 cut(s) 95
BssHII GCGCGC 1 cut(s) 79
BssMI GATC 1 cut(s) 66
BstBI TTCGAA 1 cut(s) 95
BstC8I GCNNGC 1 cut(s) 81
BstF5I GGATG 1 cut(s) 67
BstFNI CGCG 2 cut(s) 81, 83
BstHHI GCGC 2 cut(s) 81, 83
BstKTI GATC 1 cut(s) 69
BstMBI GATC 1 cut(s) 66
BstMWI GCNNNNNNNGC 1 cut(s) 89
BstUI CGCG 2 cut(s) 81, 83
BtsCI GGATG 1 cut(s) 67
Cac8I GCNNGC 1 cut(s) 81
CfoI GCGC 2 cut(s) 81, 83
CviAII CATG 2 cut(s) 122, 152
CviJI RGCY 2 cut(s) 6, 107
CviKI_1 RGCY 2 cut(s) 6, 107
DpnI GATC 1 cut(s) 68
DpnII GATC 1 cut(s) 66
Ecl136II GAGCTC 1 cut(s) 6
Eco24I GRGCYC 1 cut(s) 8
Eco53kI GAGCTC 1 cut(s) 6
EcoICRI GAGCTC 1 cut(s) 6
EcoT38I GRGCYC 1 cut(s) 8
FaeI CATG 2 cut(s) 125, 155
FaiI YATR 3 cut(s) 123, 133, 153
FatI CATG 2 cut(s) 121, 151
FokI GGATG 1 cut(s) 74
FriOI GRGCYC 1 cut(s) 8
FspBI CTAG 1 cut(s) 108
GlaI GCGC 2 cut(s) 80, 82
HhaI GCGC 2 cut(s) 81, 83
Hin1II CATG 2 cut(s) 125, 155
Hin6I GCGC 2 cut(s) 79, 81
HinP1I GCGC 2 cut(s) 79, 81
HinfI GANTC 3 cut(s) 31, 145, 158
Hpy188I TCNGA 3 cut(s) 10, 71, 144
Hpy188III TCNNGA 1 cut(s) 162
HpyCH4V TGCA 1 cut(s) 121
HpyF10VI GCNNNNNNNGC 1 cut(s) 89
Hsp92II CATG 2 cut(s) 125, 155
HspAI GCGC 2 cut(s) 79, 81
Kzo9I GATC 1 cut(s) 66
LmnI GCTCC 1 cut(s) 11
LpnPI CCDG 1 cut(s) 44
LweI GCATC 2 cut(s) 79, 115
MaeI CTAG 1 cut(s) 108
MalI GATC 1 cut(s) 68
MboI GATC 1 cut(s) 66
MhlI GDGCHC 1 cut(s) 8
MmeI TCCRAC 1 cut(s) 33
MnlI CCTC 5 cut(s) 21, 34, 94, 97, 159
MvnI CGCG 2 cut(s) 81, 83
MwoI GCNNNNNNNGC 1 cut(s) 89
NdeII GATC 1 cut(s) 66
NlaIII CATG 2 cut(s) 125, 155
NspV TTCGAA 1 cut(s) 95
PauI GCGCGC 1 cut(s) 79
PfeI GAWTC 3 cut(s) 31, 145, 158
Psp124BI GAGCTC 1 cut(s) 8
PteI GCGCGC 1 cut(s) 79
SacI GAGCTC 1 cut(s) 8
Sau3AI GATC 1 cut(s) 66
SduI GDGCHC 1 cut(s) 8
SetI ASST 1 cut(s) 8
SfaNI GCATC 2 cut(s) 79, 115
SfuI TTCGAA 1 cut(s) 95
SgeI CNNG 6 cut(s) 49, 71, 92, 94, 120, 134
SspMI CTAG 1 cut(s) 108
SstI GAGCTC 1 cut(s) 8
TaqI TCGA 1 cut(s) 95
TfiI GAWTC 3 cut(s) 31, 145, 158
XspI CTAG 1 cut(s) 108
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.