Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0020359.1

Orthogroup ID

OG0002939

Physical Location & Seq

Genomic Coordinates Reverse (-)

3474 .. 3830

Gene Structure 357 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0020359.1_g000002.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 213 bp

atgatatcggagctgcttgattcggggaaggcggtgttcaagaagatcactgatgattatgaggagcgattgattatgattcacaaggagcaaatggagaaatggcaggaggagatcagagagttgcgtgcgattgatgcttcgaatgaggaggctagtgctgtgctgcataatgctacatatctgcttcagaatcctcatgttgattcttga

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

70

Amino Acids

8.17

Weight (kDa)

4.76

Isoelectric Point (pI)

48.07

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0002939)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G03050 AT5G03050
fragaria_vesca	FvH4_6g36280
malus_domestica	MD17G1156700.v1.1
prunus_persica	Prupe.3G028700_v2.0.a1 Prupe.3G028700_v2.0.a1
rosa_chinensis	RchiOBHm_Chr2g0148291
rosa_laevigata	RLG00000020333
rosa_multiflora	Rmu_sc0002586.1_g000002 Rmu_sc0004032.1_g000014 Rmu_sc0006888.1_g000017 Rmu_sc0013350.1_g000016 Rmu_sc0015777.1_g000003 Rmu_sc0020359.1_g000002
rosa_roxburghii	Rroxscaffold_2G00098940 Rroxscaffold_2G00129240 Rroxscaffold_3G00245520 Rroxscaffold_4G00297960 Rroxscaffold_4G00331090
rosa_rugosa	Rorug02G0405300 Rorug04G0114800 Rorug06G0390700
rosa_samantha	Rh1BG203400 Rh1DG153600 Rh1DG230400 Rh2AG464000 Rh2BG477000 Rh2CG450700 Rh2DG485800 Rh5AG015200 Rh5AG348400 Rh5CG016300 Rh5CG305700 Rh5DG523500 Rh6AG225300 Rh7DG482800
rosa_wichuraiana	Rw2G037820 Rw4G021890

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	32
AcuI	CTGAAG	1 cut(s)	173
AgsI	TTSAA	1 cut(s)	40
AluBI	AGCT	1 cut(s)	13
AluI	AGCT	1 cut(s)	13
ApeKI	GCWGC	2 cut(s)	13, 166
AsuII	TTCGAA	1 cut(s)	143
BbvI	GCAGC	1 cut(s)	153
BfaI	CTAG	1 cut(s)	156
BisI	GCNGC	2 cut(s)	14, 167
BlsI	GCNGC	2 cut(s)	15, 168
BmsI	GCATC	1 cut(s)	127
Bpu14I	TTCGAA	1 cut(s)	143
BseRI	GAGGAG	3 cut(s)	77, 125, 164
BseXI	GCAGC	1 cut(s)	153
Bsp119I	TTCGAA	1 cut(s)	143
Bsp143I	GATC	2 cut(s)	45, 114
BspACI	CCGC	1 cut(s)	32
BspT104I	TTCGAA	1 cut(s)	143
BssMI	GATC	2 cut(s)	45, 114
BstBI	TTCGAA	1 cut(s)	143
BstC8I	GCNNGC	1 cut(s)	129
BstKTI	GATC	2 cut(s)	48, 117
BstMBI	GATC	2 cut(s)	45, 114
BstMWI	GCNNNNNNNGC	1 cut(s)	137
BstV1I	GCAGC	1 cut(s)	153
BtsIMutI	CAGTG	1 cut(s)	48
Cac8I	GCNNGC	1 cut(s)	129
CviAII	CATG	1 cut(s)	200
CviJI	RGCY	2 cut(s)	13, 155
CviKI_1	RGCY	2 cut(s)	13, 155
DpnI	GATC	2 cut(s)	47, 116
DpnII	GATC	2 cut(s)	45, 114
Eco32I	GATATC	1 cut(s)	6
Eco57I	CTGAAG	1 cut(s)	173
EcoRV	GATATC	1 cut(s)	6
FaeI	CATG	1 cut(s)	203
FaiI	YATR	5 cut(s)	60, 77, 171, 181, 201
FatI	CATG	1 cut(s)	199
Fnu4HI	GCNGC	2 cut(s)	14, 167
Fsp4HI	GCNGC	2 cut(s)	14, 167
FspBI	CTAG	1 cut(s)	156
GluI	GCNGC	2 cut(s)	14, 167
Hin1II	CATG	1 cut(s)	203
HinfI	GANTC	4 cut(s)	20, 79, 193, 206
Hpy188I	TCNGA	3 cut(s)	10, 119, 192
Hpy188III	TCNNGA	2 cut(s)	40, 210
HpyAV	CCTTC	1 cut(s)	22
HpyCH4V	TGCA	1 cut(s)	169
HpyF10VI	GCNNNNNNNGC	1 cut(s)	137
Hsp92II	CATG	1 cut(s)	203
Kzo9I	GATC	2 cut(s)	45, 114
LmnI	GCTCC	3 cut(s)	10, 64, 88
LpnPI	CCDG	1 cut(s)	92
Lsp1109I	GCAGC	1 cut(s)	153
LweI	GCATC	1 cut(s)	127
MaeI	CTAG	1 cut(s)	156
MalI	GATC	2 cut(s)	47, 116
MboI	GATC	2 cut(s)	45, 114
MboII	GAAGA	1 cut(s)	55
MnlI	CCTC	5 cut(s)	55, 103, 142, 145, 207
MwoI	GCNNNNNNNGC	1 cut(s)	137
NdeII	GATC	2 cut(s)	45, 114
NlaIII	CATG	1 cut(s)	203
NspV	TTCGAA	1 cut(s)	143
PfeI	GAWTC	4 cut(s)	20, 79, 193, 206
PkrI	GCNGC	2 cut(s)	15, 168
SatI	GCNGC	2 cut(s)	14, 167
Sau3AI	GATC	2 cut(s)	45, 114
SetI	ASST	1 cut(s)	15
SfaNI	GCATC	1 cut(s)	127
SfuI	TTCGAA	1 cut(s)	143
SgeI	CNNG	7 cut(s)	29, 36, 52, 97, 119, 140, 168
SsiI	CCGC	1 cut(s)	32
SspMI	CTAG	1 cut(s)	156
TaqI	TCGA	1 cut(s)	143
TfiI	GAWTC	4 cut(s)	20, 79, 193, 206
TscAI	CASTG	1 cut(s)	55
TseI	GCWGC	2 cut(s)	13, 166
TspRI	CASTG	1 cut(s)	55
XspI	CTAG	1 cut(s)	156

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.