FvH4_2g12792

Zinc knuckle

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb2
Physical Location & Seq
Forward (+)
11241266 .. 11242365
1100 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_2g12792.t1

Sequence Viewer

Length: 273 bp
ATGAAGGAGGCGACGTCGAAAAACATGAATACTTTGAAGTATAAATTGTCATTTAGAGCAGATGTTCCTCCAGGAATGATTGAACACCCTGGGAATTGTAGTGTTCAAGCCACTTTCAATGTGGTAGATCTTTCGCCATACTATGAGCATGATTATGAAGAGAATTTAGTGACGAGTTCACGGGAAGCGGAAACGAATGACACTGATGACGACTTTGAACCTGGACAAAACCGAGGATTGGCTACATTTCTTGAAGAAGATGATCGGTTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

91

Amino Acids

10.28

Weight (kDa)

4.32

Isoelectric Point (pI)

26.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 17
AciI CCGC 1 cut(s) 188
AcsI RAATTY 1 cut(s) 163
AcyI GRCGYC 1 cut(s) 14
AfiI CCNNNNNNNGG 1 cut(s) 238
AgsI TTSAA 6 cut(s) 37, 83, 107, 118, 218, 254
AjnI CCWGG 3 cut(s) 70, 88, 220
ApoI RAATTY 1 cut(s) 163
BciT130I CCWGG 3 cut(s) 72, 90, 222
BglII AGATCT 1 cut(s) 127
Bme1390I CCNGG 3 cut(s) 72, 90, 222
BmrFI CCNGG 3 cut(s) 72, 90, 222
BpmI CTGGAG 1 cut(s) 54
BsaHI GRCGYC 1 cut(s) 14
BsaJI CCNNGG 3 cut(s) 88, 89, 232
BsaXI ACNNNNNCTCC 1 cut(s) 29
Bsc4I CCNNNNNNNGG 1 cut(s) 238
BseBI CCWGG 3 cut(s) 72, 90, 222
BseDI CCNNGG 3 cut(s) 88, 89, 232
BseLI CCNNNNNNNGG 1 cut(s) 238
BslI CCNNNNNNNGG 1 cut(s) 238
Bsp143I GATC 2 cut(s) 127, 262
BspACI CCGC 1 cut(s) 188
BssECI CCNNGG 3 cut(s) 88, 89, 232
BssMI GATC 2 cut(s) 127, 262
BssNI GRCGYC 1 cut(s) 14
Bst2UI CCWGG 3 cut(s) 72, 90, 222
Bst6I CTCTTC 1 cut(s) 153
BstACI GRCGYC 1 cut(s) 14
BstKTI GATC 2 cut(s) 130, 265
BstMBI GATC 2 cut(s) 127, 262
BstNI CCWGG 3 cut(s) 72, 90, 222
BstSCI CCNGG 3 cut(s) 70, 88, 220
BstX2I RGATCY 1 cut(s) 127
BstYI RGATCY 1 cut(s) 127
BtsIMutI CAGTG 1 cut(s) 201
CviAII CATG 2 cut(s) 25, 149
CviJI RGCY 2 cut(s) 110, 242
CviKI_1 RGCY 2 cut(s) 110, 242
DpnI GATC 2 cut(s) 129, 264
DpnII GATC 2 cut(s) 127, 262
Eam1104I CTCTTC 1 cut(s) 153
EarI CTCTTC 1 cut(s) 153
EcoRII CCWGG 3 cut(s) 70, 88, 220
FaeI CATG 2 cut(s) 28, 152
FaiI YATR 6 cut(s) 26, 42, 139, 144, 150, 156
FatI CATG 2 cut(s) 24, 148
GsuI CTGGAG 1 cut(s) 54
Hin1I GRCGYC 1 cut(s) 14
Hin1II CATG 2 cut(s) 28, 152
Hpy166II GTNNAC 1 cut(s) 179
Hpy188III TCNNGA 1 cut(s) 251
Hpy8I GTNNAC 1 cut(s) 179
Hpy99I CGWCG 2 cut(s) 16, 19
HpyCH4IV ACGT 1 cut(s) 14
HpySE526I ACGT 1 cut(s) 14
Hsp92I GRCGYC 1 cut(s) 14
Hsp92II CATG 2 cut(s) 28, 152
Kzo9I GATC 2 cut(s) 127, 262
LpnPI CCDG 6 cut(s) 57, 75, 84, 102, 207, 234
MaeII ACGT 1 cut(s) 14
MaeIII GTNAC 1 cut(s) 169
MalI GATC 2 cut(s) 129, 264
MboI GATC 2 cut(s) 127, 262
MboII GAAGA 3 cut(s) 170, 266, 269
MflI RGATCY 1 cut(s) 127
MluCI AATT 3 cut(s) 44, 94, 163
MnlI CCTC 2 cut(s) 78, 227
MslI CAYNNNNRTG 1 cut(s) 153
MspR9I CCNGG 3 cut(s) 72, 90, 222
MvaI CCWGG 3 cut(s) 72, 90, 222
NdeII GATC 2 cut(s) 127, 262
NlaIII CATG 2 cut(s) 28, 152
NmuCI GTSAC 1 cut(s) 169
PasI CCCWGGG 1 cut(s) 89
PfoI TCCNGGA 1 cut(s) 70
Psp6I CCWGG 3 cut(s) 70, 88, 220
PspGI CCWGG 3 cut(s) 70, 88, 220
PsuI RGATCY 1 cut(s) 127
RseI CAYNNNNRTG 1 cut(s) 153
Sau3AI GATC 2 cut(s) 127, 262
ScrFI CCNGG 3 cut(s) 72, 90, 222
SetI ASST 2 cut(s) 17, 223
SmiMI CAYNNNNRTG 1 cut(s) 153
Sse9I AATT 3 cut(s) 44, 94, 163
SsiI CCGC 1 cut(s) 188
StyD4I CCNGG 3 cut(s) 70, 88, 220
TaiI ACGT 1 cut(s) 17
TaqI TCGA 1 cut(s) 17
TasI AATT 3 cut(s) 44, 94, 163
TscAI CASTG 1 cut(s) 208
TseFI GTSAC 1 cut(s) 169
Tsp45I GTSAC 1 cut(s) 169
TspDTI ATGAA 3 cut(s) 17, 41, 171
TspRI CASTG 1 cut(s) 208
XapI RAATTY 1 cut(s) 163
XcmI CCANNNNNNNNNTGG 1 cut(s) 118
ZraI GACGTC 1 cut(s) 15
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.