RchiOBHm_Chr7g0243231

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Reverse (-)
69532012 .. 69533147
1136 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ21798

Sequence Viewer

Length: 246 bp
ATGATCGTACTTGCTCATTTCTTATTAGGCTGTGATGGAGGATCTACATGGCAGAGGCCGTTGAAAGTCTATAAGAGACGTGGTAAAGAAGGTTCCAAGGCTCAAGCCTTGATCTGGCACTCAGTAGGCGATGATGGAATCTTCTTAAGCCTAGGGATGTTAGGATTATTTGGTCCTAGTTGTTCAAGGGTTGTTTTAGCTTCTCTATATATTGAGGCTTTTGTAGTCTTTTATTTTCATATTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

81

Amino Acids

8.98

Weight (kDa)

9.14

Isoelectric Point (pI)

41.38

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 49
AfaI GTAC 1 cut(s) 9
AfiI CCNNNNNNNGG 1 cut(s) 114
AflII CTTAAG 1 cut(s) 145
AgsI TTSAA 2 cut(s) 64, 186
AjiI CACGTC 1 cut(s) 80
AluBI AGCT 1 cut(s) 200
AluI AGCT 1 cut(s) 200
Alw26I GTCTC 1 cut(s) 70
AlwI GGATC 1 cut(s) 49
AoxI GGCC 1 cut(s) 56
AspA2I CCTAGG 1 cut(s) 151
AspS9I GGNCC 1 cut(s) 173
AvaII GGWCC 1 cut(s) 173
AvrII CCTAGG 1 cut(s) 151
BccI CCATC 2 cut(s) 29, 128
BceAI ACGGC 1 cut(s) 43
BcoDI GTCTC 1 cut(s) 70
BfaI CTAG 2 cut(s) 152, 177
BfrI CTTAAG 1 cut(s) 145
BlnI CCTAGG 1 cut(s) 151
Bme18I GGWCC 1 cut(s) 173
BmgBI CACGTC 1 cut(s) 80
BmgT120I GGNCC 1 cut(s) 173
BmiI GGNNCC 1 cut(s) 94
BpuEI CTTGAG 1 cut(s) 87
BsaJI CCNNGG 2 cut(s) 96, 151
Bsc4I CCNNNNNNNGG 1 cut(s) 114
BseDI CCNNGG 2 cut(s) 96, 151
BseGI GGATG 1 cut(s) 162
BseLI CCNNNNNNNGG 1 cut(s) 114
BseMII CTCAG 1 cut(s) 135
BshFI GGCC 1 cut(s) 58
BslI CCNNNNNNNGG 1 cut(s) 114
BsmAI GTCTC 1 cut(s) 70
BsmBI CGTCTC 1 cut(s) 70
BsnI GGCC 1 cut(s) 58
Bsp143I GATC 3 cut(s) 3, 41, 111
BspANI GGCC 1 cut(s) 58
BspCNI CTCAG 1 cut(s) 134
BspLI GGNNCC 1 cut(s) 94
BspPI GGATC 1 cut(s) 49
BspTI CTTAAG 1 cut(s) 145
BssECI CCNNGG 2 cut(s) 96, 151
BssMI GATC 3 cut(s) 3, 41, 111
BssT1I CCWWGG 2 cut(s) 96, 151
BstAFI CTTAAG 1 cut(s) 145
BstDEI CTNAG 1 cut(s) 121
BstF5I GGATG 1 cut(s) 162
BstKTI GATC 3 cut(s) 6, 44, 114
BstMAI GTCTC 1 cut(s) 70
BstMBI GATC 3 cut(s) 3, 41, 111
BstX2I RGATCY 1 cut(s) 41
BstYI RGATCY 1 cut(s) 41
BsuRI GGCC 1 cut(s) 58
BtgZI GCGATG 1 cut(s) 144
BtrI CACGTC 1 cut(s) 80
BtsCI GGATG 1 cut(s) 162
Cfr13I GGNCC 1 cut(s) 173
Csp6I GTAC 1 cut(s) 8
CviAII CATG 1 cut(s) 48
CviJI RGCY 7 cut(s) 30, 58, 101, 107, 150, 200, 218
CviKI_1 RGCY 7 cut(s) 30, 58, 101, 107, 150, 200, 218
CviQI GTAC 1 cut(s) 8
DdeI CTNAG 1 cut(s) 121
DpnI GATC 3 cut(s) 5, 43, 113
DpnII GATC 3 cut(s) 3, 41, 111
Eco130I CCWWGG 2 cut(s) 96, 151
Eco47I GGWCC 1 cut(s) 173
EcoT14I CCWWGG 2 cut(s) 96, 151
ErhI CCWWGG 2 cut(s) 96, 151
Esp3I CGTCTC 1 cut(s) 70
FaeI CATG 1 cut(s) 51
FaiI YATR 5 cut(s) 49, 72, 208, 210, 240
FatI CATG 1 cut(s) 47
FokI GGATG 1 cut(s) 169
FspBI CTAG 2 cut(s) 152, 177
HaeIII GGCC 1 cut(s) 58
Hin1II CATG 1 cut(s) 51
HinfI GANTC 1 cut(s) 138
HpyAV CCTTC 1 cut(s) 83
HpyCH4IV ACGT 1 cut(s) 79
HpyF3I CTNAG 1 cut(s) 121
HpySE526I ACGT 1 cut(s) 79
Hsp92II CATG 1 cut(s) 51
Kzo9I GATC 3 cut(s) 3, 41, 111
LpnPI CCDG 1 cut(s) 100
MaeI CTAG 2 cut(s) 152, 177
MaeII ACGT 1 cut(s) 79
MalI GATC 3 cut(s) 5, 43, 113
MboI GATC 3 cut(s) 3, 41, 111
MboII GAAGA 1 cut(s) 133
MflI RGATCY 1 cut(s) 41
MnlI CCTC 3 cut(s) 32, 48, 208
MseI TTAA 1 cut(s) 146
MspCI CTTAAG 1 cut(s) 145
NdeII GATC 3 cut(s) 3, 41, 111
NlaIII CATG 1 cut(s) 51
NlaIV GGNNCC 1 cut(s) 94
PfeI GAWTC 1 cut(s) 138
PspN4I GGNNCC 1 cut(s) 94
PspPI GGNCC 1 cut(s) 173
PsrI GAACNNNNNNTAC 2 cut(s) 76, 108
PsuI RGATCY 1 cut(s) 41
RsaI GTAC 1 cut(s) 9
RsaNI GTAC 1 cut(s) 8
SaqAI TTAA 1 cut(s) 146
Sau3AI GATC 3 cut(s) 3, 41, 111
Sau96I GGNCC 1 cut(s) 173
SetI ASST 3 cut(s) 82, 94, 202
SinI GGWCC 1 cut(s) 173
SmlI CTYRAG 2 cut(s) 102, 145
SmoI CTYRAG 2 cut(s) 102, 145
SspMI CTAG 2 cut(s) 152, 177
StyI CCWWGG 2 cut(s) 96, 151
TaiI ACGT 1 cut(s) 82
TfiI GAWTC 1 cut(s) 138
Tru1I TTAA 1 cut(s) 146
Tru9I TTAA 1 cut(s) 146
TspDTI ATGAA 1 cut(s) 227
Vha464I CTTAAG 1 cut(s) 145
VpaK11BI GGWCC 1 cut(s) 173
XmaJI CCTAGG 1 cut(s) 151
XspI CTAG 2 cut(s) 152, 177
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.