Basic Information

Type: gene

Biological Identity

Species

fragaria_vesca

Chromosome

Fvb3

Orthogroup ID

OG0004532

Physical Location & Seq

Genomic Coordinates Reverse (-)

6386500 .. 6387054

Gene Structure 555 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

FvH4_3g10730.t1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 525 bp

ATGGGGTTGTGCTGTTACTCCAAGCTAGCACAAGCTGACAATTTCTCCTTTGGAGGACTTCACATCCCTGGAAACACCTCAAACCCTCTTGGCGTTAATGTTACCCCAGTAAATGTGGCTCAAATTCCAGGACTCAACACCCTCGGCATCTCACTGGCTCGAATTCACTATGCACCAGGTGGTGTTACCCCTCCCCACACTCATCCTCGTGCGACTGAGATTCTGACAGTTGTTAAAGGCAAGCTCTATGTTGGCTTTGTGACTTCCAACCCAGAGAATAAGCTCATCTCAAAGGTCCTCAATAAGGGTGATGTGTTTGTATTCCCTGTTGGACTAGTCCACTTCCAGCAAAATCTGGGATCTGGAACAGCCATTTCGCAGTCTTCTTTGAGCAGCCAAAACCCTGGAGTCATCACTGTTGCAAACTCAGTTTTTGGACCCAATCCCTCAATTTCAGATGATGTTCTGGCCACGGCTTTCCAAGTTGACAAATCCATTATCAGCGGTCTGCAAGCACAATTTTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005618 GO:0005623 GO:0030312 GO:0044464 GO:0071944

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Cupin_1

Protein Analysis

175

Amino Acids

18.14

Weight (kDa)

8.64

Isoelectric Point (pI)

27.45

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Cupin_1	PF00190	20 - 165	5.9e-49	Cupin
Cupin_2	PF07883	54 - 123	1.5e-09	Cupin domain

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004532)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g10240 FvH4_3g10730
malus_domestica	MD05G1269200.v1.1 MD05G1271400.v1.1 MD05G1271500.v1.1 MD10G1248000.v1.1 MD10G1251900.v1.1 MD10G1252000.v1.1 MD14G1081700.v1.1
prunus_persica	Prupe.4G091500_v2.0.a1 Prupe.4G095500_v2.0.a1 Prupe.4G095600_v2.0.a1
pyrus_communis	pycom10g20550 pycom10g20790
rosa_chinensis	RchiOBHm_Chr5g0016481 RchiOBHm_Chr5g0017421
rosa_laevigata	RLG00000032286
rosa_multiflora	Rmu_co8334417.1_g000001 Rmu_sc0001235.1_g000024 Rmu_sc0007392.1_g000005 Rmu_sc0019163.1_g000002
rosa_roxburghii	Rroxscaffold_1G00059970
rosa_rugosa	Rorug05G0032500 Rorug05G0035300
rosa_samantha	Rh5AG126500 Rh5AG130000 Rh5BG125300 Rh5CG137900 Rh5DG125500 Rh5DG130300
rosa_wichuraiana	Rw5G010960 Rw5G011230

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	504
AclWI	GGATC	1 cut(s)	367
AcoI	YGGCCR	1 cut(s)	468
AcsI	RAATTY	2 cut(s)	123, 162
AdeI	CACNNNGTG	1 cut(s)	179
AfiI	CCNNNNNNNGG	1 cut(s)	304
AhlI	ACTAGT	1 cut(s)	334
AjnI	CCWGG	4 cut(s)	67, 127, 175, 403
AluBI	AGCT	4 cut(s)	25, 35, 244, 283
AluI	AGCT	4 cut(s)	25, 35, 244, 283
AlwI	GGATC	1 cut(s)	367
AoxI	GGCC	1 cut(s)	468
ApeKI	GCWGC	1 cut(s)	393
ApoI	RAATTY	2 cut(s)	123, 162
AspS9I	GGNCC	2 cut(s)	295, 437
AsuHPI	GGTGA	1 cut(s)	320
AsuNHI	GCTAGC	1 cut(s)	25
AvaII	GGWCC	2 cut(s)	295, 437
BalI	TGGCCA	1 cut(s)	470
BauI	CACGAG	1 cut(s)	207
BbsI	GAAGAC	1 cut(s)	375
BbvI	GCAGC	1 cut(s)	405
BceAI	ACGGC	1 cut(s)	489
BciT130I	CCWGG	4 cut(s)	69, 129, 177, 405
BcuI	ACTAGT	1 cut(s)	334
BfaI	CTAG	2 cut(s)	26, 335
BisI	GCNGC	1 cut(s)	394
BlsI	GCNGC	1 cut(s)	395
Bme1390I	CCNGG	4 cut(s)	69, 129, 177, 405
Bme18I	GGWCC	2 cut(s)	295, 437
BmgT120I	GGNCC	2 cut(s)	295, 437
BmiI	GGNNCC	1 cut(s)	439
BmrFI	CCNGG	4 cut(s)	69, 129, 177, 405
BmrI	ACTGGG	1 cut(s)	101
BmsI	GCATC	1 cut(s)	156
BmtI	GCTAGC	1 cut(s)	29
BmuI	ACTGGG	1 cut(s)	101
BpiI	GAAGAC	1 cut(s)	375
BpmI	CTGGAG	1 cut(s)	426
BsaJI	CCNNGG	4 cut(s)	67, 142, 403, 471
BsaXI	ACNNNNNCTCC	2 cut(s)	29, 59
Bsc4I	CCNNNNNNNGG	1 cut(s)	304
Bse1I	ACTGG	2 cut(s)	107, 159
BseBI	CCWGG	4 cut(s)	69, 129, 177, 405
BseDI	CCNNGG	4 cut(s)	67, 142, 403, 471
BseGI	GGATG	2 cut(s)	63, 202
BseLI	CCNNNNNNNGG	1 cut(s)	304
BseMII	CTCAG	2 cut(s)	207, 441
BseNI	ACTGG	2 cut(s)	107, 159
BseXI	GCAGC	1 cut(s)	405
BshFI	GGCC	1 cut(s)	470
BslI	CCNNNNNNNGG	1 cut(s)	304
BsnI	GGCC	1 cut(s)	470
Bsp143I	GATC	1 cut(s)	359
BspACI	CCGC	1 cut(s)	504
BspANI	GGCC	1 cut(s)	470
BspCNI	CTCAG	2 cut(s)	208, 440
BspLI	GGNNCC	1 cut(s)	439
BspOI	GCTAGC	1 cut(s)	29
BspPI	GGATC	1 cut(s)	367
BsrI	ACTGG	2 cut(s)	107, 159
BssECI	CCNNGG	4 cut(s)	67, 142, 403, 471
BssMI	GATC	1 cut(s)	359
BssSI	CACGAG	1 cut(s)	207
Bst2BI	CACGAG	1 cut(s)	207
Bst2UI	CCWGG	4 cut(s)	69, 129, 177, 405
Bst4CI	ACNGT	2 cut(s)	229, 418
BstC8I	GCNNGC	3 cut(s)	27, 242, 513
BstDEI	CTNAG	2 cut(s)	216, 427
BstDSI	CCRYGG	1 cut(s)	471
BstENI	CCTNNNNNAGG	1 cut(s)	302
BstF5I	GGATG	2 cut(s)	63, 202
BstKTI	GATC	1 cut(s)	362
BstMBI	GATC	1 cut(s)	359
BstNI	CCWGG	4 cut(s)	69, 129, 177, 405
BstSCI	CCNGG	4 cut(s)	67, 127, 175, 403
BstV1I	GCAGC	1 cut(s)	405
BstV2I	GAAGAC	1 cut(s)	375
BstX2I	RGATCY	1 cut(s)	359
BstXI	CCANNNNNNTGG	1 cut(s)	404
BstYI	RGATCY	1 cut(s)	359
BsuRI	GGCC	1 cut(s)	470
BtgI	CCRYGG	1 cut(s)	471
BtsCI	GGATG	2 cut(s)	63, 202
BtsIMutI	CAGTG	2 cut(s)	152, 414
Cac8I	GCNNGC	3 cut(s)	27, 242, 513
Cfr13I	GGNCC	2 cut(s)	295, 437
CsiI	ACCWGGT	1 cut(s)	175
DdeI	CTNAG	2 cut(s)	216, 427
DpnI	GATC	1 cut(s)	361
DpnII	GATC	1 cut(s)	359
DraIII	CACNNNGTG	1 cut(s)	179
EaeI	YGGCCR	1 cut(s)	468
Eco47I	GGWCC	2 cut(s)	295, 437
EcoNI	CCTNNNNNAGG	1 cut(s)	302
EcoO109I	RGGNCCY	1 cut(s)	295
EcoRI	GAATTC	1 cut(s)	162
EcoRII	CCWGG	4 cut(s)	67, 127, 175, 403
FaiI	YATR	2 cut(s)	171, 249
Fnu4HI	GCNGC	1 cut(s)	394
FokI	GGATG	2 cut(s)	50, 189
Fsp4HI	GCNGC	1 cut(s)	394
FspBI	CTAG	2 cut(s)	26, 335
GluI	GCNGC	1 cut(s)	394
GsuI	CTGGAG	1 cut(s)	426
HaeIII	GGCC	1 cut(s)	470
HincII	GTYRAC	1 cut(s)	487
HindII	GTYRAC	1 cut(s)	487
HinfI	GANTC	3 cut(s)	132, 220, 408
HphI	GGTGA	1 cut(s)	320
Hpy166II	GTNNAC	2 cut(s)	340, 487
Hpy188I	TCNGA	2 cut(s)	225, 457
Hpy188III	TCNNGA	1 cut(s)	363
Hpy8I	GTNNAC	2 cut(s)	340, 487
HpyCH4III	ACNGT	2 cut(s)	229, 418
HpyCH4V	TGCA	3 cut(s)	173, 422, 511
HpyF3I	CTNAG	2 cut(s)	216, 427
Kzo9I	GATC	1 cut(s)	359
Lsp1109I	GCAGC	1 cut(s)	405
LweI	GCATC	1 cut(s)	156
MabI	ACCWGGT	1 cut(s)	175
MaeI	CTAG	2 cut(s)	26, 335
MaeIII	GTNAC	4 cut(s)	14, 100, 184, 259
MalI	GATC	1 cut(s)	361
MboI	GATC	1 cut(s)	359
MboII	GAAGA	1 cut(s)	375
MflI	RGATCY	1 cut(s)	359
MlsI	TGGCCA	1 cut(s)	470
MluCI	AATT	5 cut(s)	40, 123, 162, 450, 518
MluNI	TGGCCA	1 cut(s)	470
MlyI	GAGTC	2 cut(s)	126, 417
MmeI	TCCRAC	2 cut(s)	291, 310
MnlI	CCTC	8 cut(s)	47, 88, 96, 152, 201, 216, 308, 457
Mox20I	TGGCCA	1 cut(s)	470
MscI	TGGCCA	1 cut(s)	470
MseI	TTAA	2 cut(s)	96, 234
MslI	CAYNNNNRTG	1 cut(s)	207
Msp20I	TGGCCA	1 cut(s)	470
MspA1I	CMGCKG	1 cut(s)	504
MspR9I	CCNGG	4 cut(s)	69, 129, 177, 405
MvaI	CCWGG	4 cut(s)	69, 129, 177, 405
NdeII	GATC	1 cut(s)	359
NheI	GCTAGC	1 cut(s)	25
NlaIV	GGNNCC	1 cut(s)	439
NmeAIII	GCCGAG	1 cut(s)	123
NmuCI	GTSAC	1 cut(s)	259
PfeI	GAWTC	1 cut(s)	220
PfoI	TCCNGGA	1 cut(s)	127
PkrI	GCNGC	1 cut(s)	395
PleI	GAGTC	2 cut(s)	126, 416
PpsI	GAGTC	2 cut(s)	126, 416
PpuMI	RGGWCCY	1 cut(s)	295
Psp5II	RGGWCCY	1 cut(s)	295
Psp6I	CCWGG	4 cut(s)	67, 127, 175, 403
PspGI	CCWGG	4 cut(s)	67, 127, 175, 403
PspN4I	GGNNCC	1 cut(s)	439
PspPI	GGNCC	2 cut(s)	295, 437
PspPPI	RGGWCCY	1 cut(s)	295
PsuI	RGATCY	1 cut(s)	359
RseI	CAYNNNNRTG	1 cut(s)	207
SaqAI	TTAA	2 cut(s)	96, 234
SatI	GCNGC	1 cut(s)	394
Sau3AI	GATC	1 cut(s)	359
Sau96I	GGNCC	2 cut(s)	295, 437
SchI	GAGTC	2 cut(s)	126, 417
ScrFI	CCNGG	4 cut(s)	69, 129, 177, 405
SetI	ASST	7 cut(s)	27, 37, 80, 181, 246, 285, 297
SexAI	ACCWGGT	1 cut(s)	175
SfaNI	GCATC	1 cut(s)	156
SinI	GGWCC	2 cut(s)	295, 437
SmiMI	CAYNNNNRTG	1 cut(s)	207
SpeI	ACTAGT	1 cut(s)	334
Sse9I	AATT	5 cut(s)	40, 123, 162, 450, 518
SsiI	CCGC	1 cut(s)	504
SspMI	CTAG	2 cut(s)	26, 335
StyD4I	CCNGG	4 cut(s)	67, 127, 175, 403
TaaI	ACNGT	2 cut(s)	229, 418
TaqI	TCGA	1 cut(s)	160
TasI	AATT	5 cut(s)	40, 123, 162, 450, 518
TfiI	GAWTC	1 cut(s)	220
Tru1I	TTAA	2 cut(s)	96, 234
Tru9I	TTAA	2 cut(s)	96, 234
TscAI	CASTG	2 cut(s)	159, 421
TseFI	GTSAC	1 cut(s)	259
TseI	GCWGC	1 cut(s)	393
Tsp45I	GTSAC	1 cut(s)	259
TspRI	CASTG	2 cut(s)	159, 421
VpaK11BI	GGWCC	2 cut(s)	295, 437
XagI	CCTNNNNNAGG	1 cut(s)	302
XapI	RAATTY	2 cut(s)	123, 162
XspI	CTAG	2 cut(s)	26, 335

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.