Rmu_sc0007392.1_g000005

Cupin domain

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007392.1
Physical Location & Seq
Forward (+)
26999 .. 27712
714 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007392.1_g000005.1.cds

Sequence Viewer

Length: 615 bp
atgacatgttctctggtcattgcattcgagcctaaaccactgcaagatttctgcattgctgacactactagctcagtaataagagtaaatgggttcccttgcttggactccaagctagcacaagctgaccatttctccttcggaggacttcacatgcccggaaacaccacaaaccctcttggcgttaaaattaccccagtcaatgtggctcaaattccaggactcaacacccttggcatctcactggctcgaattgactatgcaccagggggtgttacccctccccacactcatcctcgtgccactgagattctgacagttgtgaaaggcaagctctatgttggctttgtgacctccaacccagagaataagctcatctcaaaggtcctcaagaagggtgatgtgtttgtgttccctattggactagttcacttccagcaaaatctgggatctggaacagccatttcacagtcttctctgagcagccaaaaccctggagtcatcactattgctaactcagtttttggacccaatccctcaatttcagatgatgttctggccaaggctttccaagttgacaaatccattattagcagtctgcaggcaaaattttag

Protein Analysis

204

Amino Acids

21.54

Weight (kDa)

8.81

Isoelectric Point (pI)

24.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 457
AcoI YGGCCR 1 cut(s) 558
AcsI RAATTY 2 cut(s) 213, 608
AfiI CCNNNNNNNGG 2 cut(s) 103, 394
AflIII ACRYGT 1 cut(s) 5
AhlI ACTAGT 1 cut(s) 424
AjnI CCWGG 3 cut(s) 217, 265, 493
AluBI AGCT 5 cut(s) 72, 115, 125, 334, 373
AluI AGCT 5 cut(s) 72, 115, 125, 334, 373
AlwI GGATC 1 cut(s) 457
AoxI GGCC 1 cut(s) 558
ApeKI GCWGC 1 cut(s) 483
ApoI RAATTY 2 cut(s) 213, 608
AspS9I GGNCC 2 cut(s) 385, 527
AsuC2I CCSGG 1 cut(s) 159
AsuHPI GGTGA 1 cut(s) 410
AsuNHI GCTAGC 1 cut(s) 115
AvaII GGWCC 2 cut(s) 385, 527
BalI TGGCCA 1 cut(s) 560
BauI CACGAG 1 cut(s) 297
BbsI GAAGAC 1 cut(s) 465
BbvI GCAGC 1 cut(s) 495
BciT130I CCWGG 3 cut(s) 219, 267, 495
BcnI CCSGG 1 cut(s) 159
BcuI ACTAGT 1 cut(s) 424
BfaI CTAG 3 cut(s) 69, 116, 425
BfmI CTRYAG 1 cut(s) 599
BisI GCNGC 1 cut(s) 484
BlsI GCNGC 1 cut(s) 485
Bme1390I CCNGG 4 cut(s) 159, 219, 267, 495
Bme18I GGWCC 2 cut(s) 385, 527
BmgT120I GGNCC 2 cut(s) 385, 527
BmiI GGNNCC 2 cut(s) 95, 529
BmrFI CCNGG 4 cut(s) 159, 219, 267, 495
BmrI ACTGGG 1 cut(s) 191
BmsI GCATC 1 cut(s) 246
BmtI GCTAGC 1 cut(s) 119
BmuI ACTGGG 1 cut(s) 191
BpiI GAAGAC 1 cut(s) 465
BpmI CTGGAG 1 cut(s) 516
BpuEI CTTGAG 1 cut(s) 374
BpuMI CCSGG 1 cut(s) 159
BsaJI CCNNGG 4 cut(s) 232, 266, 493, 561
BsaXI ACNNNNNCTCC 2 cut(s) 119, 149
Bsc4I CCNNNNNNNGG 2 cut(s) 103, 394
Bse1I ACTGG 2 cut(s) 197, 249
Bse3DI GCAATG 2 cut(s) 18, 54
BseBI CCWGG 3 cut(s) 219, 267, 495
BseDI CCNNGG 4 cut(s) 232, 266, 493, 561
BseGI GGATG 1 cut(s) 292
BseLI CCNNNNNNNGG 2 cut(s) 103, 394
BseMI GCAATG 2 cut(s) 18, 54
BseMII CTCAG 4 cut(s) 87, 297, 470, 531
BseNI ACTGG 2 cut(s) 197, 249
BseXI GCAGC 1 cut(s) 495
BshFI GGCC 1 cut(s) 560
BsiSI CCGG 1 cut(s) 159
BslI CCNNNNNNNGG 2 cut(s) 103, 394
BsmI GAATGC 1 cut(s) 23
BsnI GGCC 1 cut(s) 560
Bsp143I GATC 1 cut(s) 449
BspANI GGCC 1 cut(s) 560
BspCNI CTCAG 4 cut(s) 86, 298, 471, 530
BspLI GGNNCC 2 cut(s) 95, 529
BspMAI CTGCAG 1 cut(s) 603
BspOI GCTAGC 1 cut(s) 119
BspPI GGATC 1 cut(s) 457
BsrDI GCAATG 2 cut(s) 18, 54
BsrI ACTGG 2 cut(s) 197, 249
BssECI CCNNGG 4 cut(s) 232, 266, 493, 561
BssMI GATC 1 cut(s) 449
BssSI CACGAG 1 cut(s) 297
BssT1I CCWWGG 2 cut(s) 232, 561
Bst2BI CACGAG 1 cut(s) 297
Bst2UI CCWGG 3 cut(s) 219, 267, 495
Bst4CI ACNGT 2 cut(s) 319, 471
BstC8I GCNNGC 3 cut(s) 117, 332, 603
BstDEI CTNAG 4 cut(s) 73, 306, 479, 517
BstENI CCTNNNNNAGG 1 cut(s) 392
BstF5I GGATG 1 cut(s) 292
BstKTI GATC 1 cut(s) 452
BstMBI GATC 1 cut(s) 449
BstNI CCWGG 3 cut(s) 219, 267, 495
BstNSI RCATGY 2 cut(s) 9, 157
BstSCI CCNGG 4 cut(s) 157, 217, 265, 493
BstSFI CTRYAG 1 cut(s) 599
BstV1I GCAGC 1 cut(s) 495
BstV2I GAAGAC 1 cut(s) 465
BstX2I RGATCY 1 cut(s) 449
BstXI CCANNNNNNTGG 1 cut(s) 494
BstYI RGATCY 1 cut(s) 449
BsuRI GGCC 1 cut(s) 560
BtsCI GGATG 1 cut(s) 292
BtsI GCAGTG 1 cut(s) 38
BtsIMutI CAGTG 3 cut(s) 38, 242, 303
Cac8I GCNNGC 3 cut(s) 117, 332, 603
Cfr13I GGNCC 2 cut(s) 385, 527
CviAII CATG 2 cut(s) 6, 154
DdeI CTNAG 4 cut(s) 73, 306, 479, 517
DpnI GATC 1 cut(s) 451
DpnII GATC 1 cut(s) 449
EaeI YGGCCR 1 cut(s) 558
Eco130I CCWWGG 2 cut(s) 232, 561
Eco47I GGWCC 2 cut(s) 385, 527
EcoNI CCTNNNNNAGG 1 cut(s) 392
EcoO109I RGGNCCY 1 cut(s) 385
EcoRII CCWGG 3 cut(s) 217, 265, 493
EcoT14I CCWWGG 2 cut(s) 232, 561
ErhI CCWWGG 2 cut(s) 232, 561
FaeI CATG 2 cut(s) 9, 157
FaiI YATR 4 cut(s) 7, 155, 261, 339
FatI CATG 2 cut(s) 5, 153
Fnu4HI GCNGC 1 cut(s) 484
FokI GGATG 1 cut(s) 279
Fsp4HI GCNGC 1 cut(s) 484
FspBI CTAG 3 cut(s) 69, 116, 425
GluI GCNGC 1 cut(s) 484
GsuI CTGGAG 1 cut(s) 516
HaeIII GGCC 1 cut(s) 560
HapII CCGG 1 cut(s) 159
Hin1II CATG 2 cut(s) 9, 157
HincII GTYRAC 1 cut(s) 577
HindII GTYRAC 1 cut(s) 577
HinfI GANTC 4 cut(s) 107, 222, 310, 498
HpaII CCGG 1 cut(s) 159
HphI GGTGA 1 cut(s) 410
Hpy166II GTNNAC 2 cut(s) 430, 577
Hpy188I TCNGA 4 cut(s) 143, 315, 480, 547
Hpy188III TCNNGA 2 cut(s) 391, 453
Hpy8I GTNNAC 2 cut(s) 430, 577
HpyAV CCTTC 2 cut(s) 148, 388
HpyCH4III ACNGT 2 cut(s) 319, 471
HpyCH4V TGCA 5 cut(s) 23, 43, 54, 263, 601
HpyF3I CTNAG 4 cut(s) 73, 306, 479, 517
Hsp92II CATG 2 cut(s) 9, 157
Kzo9I GATC 1 cut(s) 449
Lsp1109I GCAGC 1 cut(s) 495
LweI GCATC 1 cut(s) 246
MaeI CTAG 3 cut(s) 69, 116, 425
MaeIII GTNAC 2 cut(s) 274, 349
MalI GATC 1 cut(s) 451
MboI GATC 1 cut(s) 449
MboII GAAGA 1 cut(s) 465
MflI RGATCY 1 cut(s) 449
MlsI TGGCCA 1 cut(s) 560
MluCI AATT 5 cut(s) 189, 213, 252, 540, 608
MluNI TGGCCA 1 cut(s) 560
MlyI GAGTC 3 cut(s) 101, 216, 507
MmeI TCCRAC 1 cut(s) 381
MnlI CCTC 7 cut(s) 137, 186, 291, 306, 364, 398, 547
Mox20I TGGCCA 1 cut(s) 560
MscI TGGCCA 1 cut(s) 560
MseI TTAA 1 cut(s) 186
MslI CAYNNNNRTG 1 cut(s) 297
Msp20I TGGCCA 1 cut(s) 560
MspI CCGG 1 cut(s) 159
MspR9I CCNGG 4 cut(s) 159, 219, 267, 495
Mva1269I GAATGC 1 cut(s) 23
MvaI CCWGG 3 cut(s) 219, 267, 495
NciI CCSGG 1 cut(s) 159
NdeII GATC 1 cut(s) 449
NheI GCTAGC 1 cut(s) 115
NlaIII CATG 2 cut(s) 9, 157
NlaIV GGNNCC 2 cut(s) 95, 529
NmuCI GTSAC 1 cut(s) 349
NspI RCATGY 2 cut(s) 9, 157
PciI ACATGT 1 cut(s) 5
PctI GAATGC 1 cut(s) 23
PfeI GAWTC 1 cut(s) 310
PfoI TCCNGGA 1 cut(s) 217
PkrI GCNGC 1 cut(s) 485
PleI GAGTC 3 cut(s) 101, 216, 506
PpsI GAGTC 3 cut(s) 101, 216, 506
PpuMI RGGWCCY 1 cut(s) 385
PscI ACATGT 1 cut(s) 5
Psp5II RGGWCCY 1 cut(s) 385
Psp6I CCWGG 3 cut(s) 217, 265, 493
PspGI CCWGG 3 cut(s) 217, 265, 493
PspN4I GGNNCC 2 cut(s) 95, 529
PspPI GGNCC 2 cut(s) 385, 527
PspPPI RGGWCCY 1 cut(s) 385
PstI CTGCAG 1 cut(s) 603
PsuI RGATCY 1 cut(s) 449
RseI CAYNNNNRTG 1 cut(s) 297
SaqAI TTAA 1 cut(s) 186
SatI GCNGC 1 cut(s) 484
Sau3AI GATC 1 cut(s) 449
Sau96I GGNCC 2 cut(s) 385, 527
SchI GAGTC 3 cut(s) 101, 216, 507
ScrFI CCNGG 4 cut(s) 159, 219, 267, 495
SetI ASST 7 cut(s) 74, 117, 127, 336, 356, 375, 387
SfaNI GCATC 1 cut(s) 246
SfcI CTRYAG 1 cut(s) 599
SinI GGWCC 2 cut(s) 385, 527
SmiMI CAYNNNNRTG 1 cut(s) 297
SmlI CTYRAG 1 cut(s) 389
SmoI CTYRAG 1 cut(s) 389
SpeI ACTAGT 1 cut(s) 424
Sse9I AATT 5 cut(s) 189, 213, 252, 540, 608
SspMI CTAG 3 cut(s) 69, 116, 425
StyD4I CCNGG 4 cut(s) 157, 217, 265, 493
StyI CCWWGG 2 cut(s) 232, 561
TaaI ACNGT 2 cut(s) 319, 471
TaqI TCGA 2 cut(s) 27, 250
TasI AATT 5 cut(s) 189, 213, 252, 540, 608
TfiI GAWTC 1 cut(s) 310
Tru1I TTAA 1 cut(s) 186
Tru9I TTAA 1 cut(s) 186
TscAI CASTG 3 cut(s) 45, 249, 310
TseFI GTSAC 1 cut(s) 349
TseI GCWGC 1 cut(s) 483
Tsp45I GTSAC 1 cut(s) 349
TspRI CASTG 3 cut(s) 45, 249, 310
VpaK11BI GGWCC 2 cut(s) 385, 527
XagI CCTNNNNNAGG 1 cut(s) 392
XapI RAATTY 2 cut(s) 213, 608
XceI RCATGY 2 cut(s) 9, 157
XspI CTAG 3 cut(s) 69, 116, 425
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.