Basic Information

Type: gene

Biological Identity

Species

fragaria_vesca

Chromosome

Fvb4

Orthogroup ID

OG0010516

Physical Location & Seq

Genomic Coordinates Forward (+)

7094626 .. 7096940

Gene Structure 2315 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

FvH4_4g07671.t1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 354 bp

ATGTTGACCATGGTCATTATTGTTGTGAAGCTAGTGCGTAAGAGTGGTGGTTTGGAGGATTTGTTTTCGAGCAAAGGGATAGATGGAGCTAGAGGAGGAGGATCAGGGCGCAGTTTCAAGAGGATTGGTGTAGCAAGCTCTCTGGACTTGGTCTCAAGAGGAAATTCCGGTGACCGGAGTCCGGCGGTAGGGAAAATTCCGGTGATCGGAGTCCGGTGGCCGGTGACCGGAGTCCGACGGCCGGTGACCAGAGTCCGACCCAAAAAGCCTCCGCAGTCACCATCATTGCCGATCAAGACATATGGCCCTCTCTCCACCTCCTACATGCAAGACCCAGTTCTCATCGCACTTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

118

Amino Acids

12.39

Weight (kDa)

11.44

Isoelectric Point (pI)

59.21

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010516)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g09570 FvH4_1g13492 FvH4_1g20681 FvH4_2g13381 FvH4_2g38462 FvH4_3g16330 FvH4_3g32140 FvH4_3g34152 FvH4_3g34592 FvH4_4g06431 FvH4_4g07671 FvH4_4g09351 FvH4_4g13941 FvH4_4g17662 FvH4_5g13181 FvH4_5g30192 FvH4_5g34551 FvH4_5g36050 FvH4_6g13191 FvH4_7g24551
rosa_chinensis	RchiOBHm_Chr5g0039671

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	2 cut(s)	185, 272
AclWI	GGATC	1 cut(s)	109
AcoI	YGGCCR	2 cut(s)	218, 239
AcsI	RAATTY	2 cut(s)	163, 195
AfiI	CCNNNNNNNGG	7 cut(s)	174, 181, 188, 206, 220, 227, 241
AgsI	TTSAA	1 cut(s)	118
AluBI	AGCT	3 cut(s)	31, 89, 138
AluI	AGCT	3 cut(s)	31, 89, 138
Alw26I	GTCTC	1 cut(s)	157
AlwI	GGATC	1 cut(s)	109
AoxI	GGCC	3 cut(s)	218, 239, 304
ApoI	RAATTY	2 cut(s)	163, 195
AspLEI	GCGC	1 cut(s)	111
AspS9I	GGNCC	1 cut(s)	305
AsuHPI	GGTGA	5 cut(s)	182, 214, 235, 256, 270
BccI	CCATC	2 cut(s)	77, 289
BceAI	ACGGC	1 cut(s)	254
BcoDI	GTCTC	1 cut(s)	157
BfaI	CTAG	2 cut(s)	32, 90
BmgT120I	GGNCC	1 cut(s)	305
BmrI	ACTGGG	1 cut(s)	329
BmuI	ACTGGG	1 cut(s)	329
BoxI	GACNNNNGTC	4 cut(s)	11, 177, 230, 251
BpuEI	CTTGAG	1 cut(s)	139
BsaI	GGTCTC	1 cut(s)	157
BsaJI	CCNNGG	1 cut(s)	9
BsaWI	WCCGGW	5 cut(s)	167, 174, 199, 213, 227
BsaXI	ACNNNNNCTCC	2 cut(s)	47, 77
Bsc4I	CCNNNNNNNGG	7 cut(s)	174, 181, 188, 206, 220, 227, 241
Bse118I	RCCGGY	2 cut(s)	220, 241
Bse1I	ACTGG	1 cut(s)	335
Bse3DI	GCAATG	1 cut(s)	284
BseDI	CCNNGG	1 cut(s)	9
BseLI	CCNNNNNNNGG	7 cut(s)	174, 181, 188, 206, 220, 227, 241
BseMI	GCAATG	1 cut(s)	284
BseNI	ACTGG	1 cut(s)	335
BseRI	GAGGAG	2 cut(s)	108, 111
BseX3I	CGGCCG	1 cut(s)	239
Bsh1285I	CGRYCG	1 cut(s)	242
BshFI	GGCC	3 cut(s)	220, 241, 306
BsiEI	CGRYCG	1 cut(s)	242
BsiSI	CCGG	8 cut(s)	168, 175, 182, 200, 214, 221, 228, 242
BslI	CCNNNNNNNGG	7 cut(s)	174, 181, 188, 206, 220, 227, 241
BsmAI	GTCTC	1 cut(s)	157
BsnI	GGCC	3 cut(s)	220, 241, 306
Bso31I	GGTCTC	1 cut(s)	157
Bsp143I	GATC	3 cut(s)	101, 204, 291
Bsp19I	CCATGG	1 cut(s)	9
BspACI	CCGC	2 cut(s)	185, 272
BspANI	GGCC	3 cut(s)	220, 241, 306
BspPI	GGATC	1 cut(s)	109
BspTNI	GGTCTC	1 cut(s)	157
BsrDI	GCAATG	1 cut(s)	284
BsrFI	RCCGGY	2 cut(s)	220, 241
BsrI	ACTGG	1 cut(s)	335
BssAI	RCCGGY	2 cut(s)	220, 241
BssECI	CCNNGG	1 cut(s)	9
BssMI	GATC	3 cut(s)	101, 204, 291
BssT1I	CCWWGG	1 cut(s)	9
BstC8I	GCNNGC	1 cut(s)	136
BstDSI	CCRYGG	1 cut(s)	9
BstEII	GGTNACC	3 cut(s)	170, 223, 244
BstHHI	GCGC	1 cut(s)	111
BstKTI	GATC	3 cut(s)	104, 207, 294
BstMAI	GTCTC	1 cut(s)	157
BstMBI	GATC	3 cut(s)	101, 204, 291
BstMCI	CGRYCG	1 cut(s)	242
BstNSI	RCATGY	1 cut(s)	328
BstPAI	GACNNNNGTC	4 cut(s)	11, 177, 230, 251
BstPI	GGTNACC	3 cut(s)	170, 223, 244
BstZI	CGGCCG	1 cut(s)	239
BsuRI	GGCC	3 cut(s)	220, 241, 306
BtgI	CCRYGG	1 cut(s)	9
BtgZI	GCGATG	1 cut(s)	328
Cac8I	GCNNGC	1 cut(s)	136
CfoI	GCGC	1 cut(s)	111
Cfr10I	RCCGGY	2 cut(s)	220, 241
Cfr13I	GGNCC	1 cut(s)	305
CviAII	CATG	2 cut(s)	10, 325
CviJI	RGCY	7 cut(s)	31, 89, 138, 220, 241, 268, 306
CviKI_1	RGCY	7 cut(s)	31, 89, 138, 220, 241, 268, 306
DpnI	GATC	3 cut(s)	103, 206, 293
DpnII	GATC	3 cut(s)	101, 204, 291
EaeI	YGGCCR	2 cut(s)	218, 239
EagI	CGGCCG	1 cut(s)	239
EclXI	CGGCCG	1 cut(s)	239
Eco130I	CCWWGG	1 cut(s)	9
Eco31I	GGTCTC	1 cut(s)	157
Eco52I	CGGCCG	1 cut(s)	239
Eco91I	GGTNACC	3 cut(s)	170, 223, 244
EcoO65I	GGTNACC	3 cut(s)	170, 223, 244
EcoT14I	CCWWGG	1 cut(s)	9
ErhI	CCWWGG	1 cut(s)	9
FaeI	CATG	2 cut(s)	13, 328
FaiI	YATR	4 cut(s)	11, 301, 303, 326
FatI	CATG	2 cut(s)	9, 324
FauNDI	CATATG	1 cut(s)	301
FspBI	CTAG	2 cut(s)	32, 90
GlaI	GCGC	1 cut(s)	110
HaeIII	GGCC	3 cut(s)	220, 241, 306
HapII	CCGG	8 cut(s)	168, 175, 182, 200, 214, 221, 228, 242
HhaI	GCGC	1 cut(s)	111
Hin1II	CATG	2 cut(s)	13, 328
Hin6I	GCGC	1 cut(s)	109
HinP1I	GCGC	1 cut(s)	109
HincII	GTYRAC	1 cut(s)	6
HindII	GTYRAC	1 cut(s)	6
HinfI	GANTC	4 cut(s)	178, 210, 231, 252
HpaII	CCGG	8 cut(s)	168, 175, 182, 200, 214, 221, 228, 242
HphI	GGTGA	5 cut(s)	182, 214, 235, 256, 270
Hpy166II	GTNNAC	1 cut(s)	6
Hpy188I	TCNGA	3 cut(s)	209, 236, 257
Hpy188III	TCNNGA	4 cut(s)	118, 143, 156, 295
Hpy8I	GTNNAC	1 cut(s)	6
Hpy99I	CGWCG	1 cut(s)	240
HpyCH4V	TGCA	1 cut(s)	328
Hsp92II	CATG	2 cut(s)	13, 328
HspAI	GCGC	1 cut(s)	109
Kzo9I	GATC	3 cut(s)	101, 204, 291
LmnI	GCTCC	1 cut(s)	86
MaeI	CTAG	2 cut(s)	32, 90
MaeIII	GTNAC	4 cut(s)	170, 223, 244, 276
MalI	GATC	3 cut(s)	103, 206, 293
MboI	GATC	3 cut(s)	101, 204, 291
MluCI	AATT	2 cut(s)	163, 195
MlyI	GAGTC	4 cut(s)	187, 219, 240, 261
MmeI	TCCRAC	2 cut(s)	259, 280
MnlI	CCTC	9 cut(s)	49, 86, 89, 92, 114, 152, 279, 318, 328
MseI	TTAA	1 cut(s)	352
MspI	CCGG	8 cut(s)	168, 175, 182, 200, 214, 221, 228, 242
NcoI	CCATGG	1 cut(s)	9
NdeI	CATATG	1 cut(s)	301
NdeII	GATC	3 cut(s)	101, 204, 291
NlaIII	CATG	2 cut(s)	13, 328
NmuCI	GTSAC	4 cut(s)	170, 223, 244, 276
NspI	RCATGY	1 cut(s)	328
PflFI	GACNNNGTC	1 cut(s)	149
PleI	GAGTC	4 cut(s)	186, 218, 239, 260
PpsI	GAGTC	4 cut(s)	186, 218, 239, 260
PshAI	GACNNNNGTC	4 cut(s)	11, 177, 230, 251
PspEI	GGTNACC	3 cut(s)	170, 223, 244
PspPI	GGNCC	1 cut(s)	305
PsyI	GACNNNGTC	1 cut(s)	149
SaqAI	TTAA	1 cut(s)	352
Sau3AI	GATC	3 cut(s)	101, 204, 291
Sau96I	GGNCC	1 cut(s)	305
SchI	GAGTC	4 cut(s)	187, 219, 240, 261
SetI	ASST	4 cut(s)	33, 91, 140, 320
SmlI	CTYRAG	1 cut(s)	154
SmoI	CTYRAG	1 cut(s)	154
Sse9I	AATT	2 cut(s)	163, 195
SsiI	CCGC	2 cut(s)	185, 272
SspMI	CTAG	2 cut(s)	32, 90
StyI	CCWWGG	1 cut(s)	9
TaqI	TCGA	1 cut(s)	68
TasI	AATT	2 cut(s)	163, 195
Tru1I	TTAA	1 cut(s)	352
Tru9I	TTAA	1 cut(s)	352
TseFI	GTSAC	4 cut(s)	170, 223, 244, 276
Tsp45I	GTSAC	4 cut(s)	170, 223, 244, 276
Tth111I	GACNNNGTC	1 cut(s)	149
XapI	RAATTY	2 cut(s)	163, 195
XceI	RCATGY	1 cut(s)	328
XspI	CTAG	2 cut(s)	32, 90

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.