FvH4_7g32070

Lipid transfer-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb7
OG0004105
Physical Location & Seq
Reverse (-)
23107467 .. 23107955
489 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_7g32070.t1

Sequence Viewer

Length: 489 bp
ATGGCTACTTCAAAGCAAAAGTTGTTTGTGATCATCTTGGCTTCATGGGCGGTTGTAGGCTTAGGCCAGTTGACGTTGGATCTTGATGAGGATATCAAGGGACCATTTCCATGCATGCAGAAACTGGCGCCTTGTCAAGTAAGAAATCAAACCACCAATGATCCTGTTCCTGAGACATGTTGTAAACCGTTGAGGGATATGCTCTTGGGTGACGATAAGAAATGCATTTGCGACGCCTTTAGCGACCCTATGGTGTTGAAGAAGCTGAACTCAACTCAGGATAATGCCATGGATCTTGTGTATTATTGTGGCGGGCAGCACAAGTCATTATGCGACGTCGACAGTAAGGATACTAAGGATAACGCAAAGCCATCTTCACCATCTTCCCCGCCAAGTCCACCGCCAGCTCATAATGCAGCCTCTCGTTTCTGCAAATCTGGTTTTGCAGCCTCGTTCATTGCAGCTCTGGTTTTTTCAGCAGCATTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LTP_2

Protein Analysis

163

Amino Acids

17.46

Weight (kDa)

6.68

Isoelectric Point (pI)

41.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 339
AccB1I GGYRCC 1 cut(s) 127
AccI GTMKAC 1 cut(s) 339
AciI CCGC 4 cut(s) 50, 312, 389, 401
AclWI GGATC 3 cut(s) 87, 155, 300
AcyI GRCGYC 3 cut(s) 128, 234, 336
AflIII ACRYGT 1 cut(s) 176
AgsI TTSAA 2 cut(s) 12, 259
AluBI AGCT 3 cut(s) 265, 407, 464
AluI AGCT 3 cut(s) 265, 407, 464
Alw26I GTCTC 1 cut(s) 167
AlwI GGATC 3 cut(s) 87, 155, 300
AlwNI CAGNNNCTG 1 cut(s) 124
AoxI GGCC 1 cut(s) 64
ApeKI GCWGC 5 cut(s) 316, 416, 446, 461, 479
AspLEI GCGC 1 cut(s) 130
AspS9I GGNCC 1 cut(s) 101
AsuHPI GGTGA 2 cut(s) 221, 369
AvaII GGWCC 1 cut(s) 101
BanI GGYRCC 1 cut(s) 127
BbvI GCAGC 4 cut(s) 328, 428, 458, 473
BccI CCATC 2 cut(s) 379, 388
BciVI GTATCC 1 cut(s) 343
BclI TGATCA 1 cut(s) 30
BcoDI GTCTC 1 cut(s) 167
BfoI RGCGCY 1 cut(s) 131
BfuI GTATCC 1 cut(s) 343
BisI GCNGC 5 cut(s) 317, 417, 447, 462, 480
BlsI GCNGC 5 cut(s) 318, 418, 448, 463, 481
Bme18I GGWCC 1 cut(s) 101
BmgT120I GGNCC 1 cut(s) 101
BmiI GGNNCC 2 cut(s) 102, 129
Bpu10I CCTNAGC 1 cut(s) 61
BsaHI GRCGYC 3 cut(s) 128, 234, 336
BsaJI CCNNGG 1 cut(s) 288
Bse1I ACTGG 2 cut(s) 67, 129
Bse3DI GCAATG 1 cut(s) 456
BseDI CCNNGG 1 cut(s) 288
BseMI GCAATG 1 cut(s) 456
BseMII CTCAG 2 cut(s) 162, 290
BseNI ACTGG 2 cut(s) 67, 129
BseXI GCAGC 4 cut(s) 328, 428, 458, 473
BshFI GGCC 1 cut(s) 66
BshNI GGYRCC 1 cut(s) 127
BslFI GGGAC 1 cut(s) 114
BsmAI GTCTC 1 cut(s) 167
BsmFI GGGAC 1 cut(s) 114
BsnI GGCC 1 cut(s) 66
Bsp143I GATC 4 cut(s) 30, 79, 160, 292
Bsp19I CCATGG 1 cut(s) 288
BspACI CCGC 4 cut(s) 50, 312, 389, 401
BspANI GGCC 1 cut(s) 66
BspCNI CTCAG 2 cut(s) 163, 289
BspLI GGNNCC 2 cut(s) 102, 129
BspPI GGATC 3 cut(s) 87, 155, 300
BspT107I GGYRCC 1 cut(s) 127
BsrDI GCAATG 1 cut(s) 456
BsrI ACTGG 2 cut(s) 67, 129
BssECI CCNNGG 1 cut(s) 288
BssMI GATC 4 cut(s) 30, 79, 160, 292
BssNI GRCGYC 3 cut(s) 128, 234, 336
BssT1I CCWWGG 1 cut(s) 288
Bst4CI ACNGT 2 cut(s) 189, 344
BstACI GRCGYC 3 cut(s) 128, 234, 336
BstC8I GCNNGC 3 cut(s) 116, 314, 405
BstDEI CTNAG 4 cut(s) 61, 171, 276, 354
BstDSI CCRYGG 1 cut(s) 288
BstH2I RGCGCY 1 cut(s) 131
BstHHI GCGC 1 cut(s) 130
BstKTI GATC 4 cut(s) 33, 82, 163, 295
BstMAI GTCTC 1 cut(s) 167
BstMBI GATC 4 cut(s) 30, 79, 160, 292
BstMWI GCNNNNNNNGC 2 cut(s) 47, 413
BstNSI RCATGY 2 cut(s) 118, 180
BstV1I GCAGC 4 cut(s) 328, 428, 458, 473
BstX2I RGATCY 2 cut(s) 79, 292
BstYI RGATCY 2 cut(s) 79, 292
BsuI GTATCC 1 cut(s) 343
BsuRI GGCC 1 cut(s) 66
BtgI CCRYGG 1 cut(s) 288
Cac8I GCNNGC 3 cut(s) 116, 314, 405
CaiI CAGNNNCTG 1 cut(s) 124
CfoI GCGC 1 cut(s) 130
Cfr13I GGNCC 1 cut(s) 101
CseI GACGC 1 cut(s) 242
CviAII CATG 5 cut(s) 45, 111, 115, 177, 289
DdeI CTNAG 4 cut(s) 61, 171, 276, 354
DinI GGCGCC 1 cut(s) 129
DpnI GATC 4 cut(s) 32, 81, 162, 294
DpnII GATC 4 cut(s) 30, 79, 160, 292
Eco130I CCWWGG 1 cut(s) 288
Eco32I GATATC 1 cut(s) 94
Eco47I GGWCC 1 cut(s) 101
EcoRV GATATC 1 cut(s) 94
EcoT14I CCWWGG 1 cut(s) 288
EcoT22I ATGCAT 2 cut(s) 116, 227
EgeI GGCGCC 1 cut(s) 129
EheI GGCGCC 1 cut(s) 129
ErhI CCWWGG 1 cut(s) 288
FaeI CATG 5 cut(s) 48, 114, 118, 180, 292
FaiI YATR 9 cut(s) 46, 112, 116, 178, 200, 251, 290, 331, 411
FaqI GGGAC 1 cut(s) 114
FatI CATG 5 cut(s) 44, 110, 114, 176, 288
FauI CCCGC 2 cut(s) 305, 396
FbaI TGATCA 1 cut(s) 30
FblI GTMKAC 1 cut(s) 339
Fnu4HI GCNGC 5 cut(s) 317, 417, 447, 462, 480
Fsp4HI GCNGC 5 cut(s) 317, 417, 447, 462, 480
GlaI GCGC 1 cut(s) 129
GluI GCNGC 5 cut(s) 317, 417, 447, 462, 480
HaeII RGCGCY 1 cut(s) 131
HaeIII GGCC 1 cut(s) 66
HgaI GACGC 1 cut(s) 242
HhaI GCGC 1 cut(s) 130
Hin1I GRCGYC 3 cut(s) 128, 234, 336
Hin1II CATG 5 cut(s) 48, 114, 118, 180, 292
Hin6I GCGC 1 cut(s) 128
HinP1I GCGC 1 cut(s) 128
HincII GTYRAC 2 cut(s) 72, 340
HindII GTYRAC 2 cut(s) 72, 340
HphI GGTGA 2 cut(s) 221, 369
Hpy166II GTNNAC 4 cut(s) 72, 185, 340, 398
Hpy188III TCNNGA 3 cut(s) 83, 170, 278
Hpy8I GTNNAC 4 cut(s) 72, 185, 340, 398
Hpy99I CGWCG 3 cut(s) 236, 338, 341
HpyCH4III ACNGT 2 cut(s) 189, 344
HpyCH4IV ACGT 2 cut(s) 74, 336
HpyCH4V TGCA 7 cut(s) 114, 118, 225, 416, 432, 446, 461
HpyF10VI GCNNNNNNNGC 2 cut(s) 47, 413
HpyF3I CTNAG 4 cut(s) 61, 171, 276, 354
HpySE526I ACGT 2 cut(s) 74, 336
Hsp92I GRCGYC 3 cut(s) 128, 234, 336
Hsp92II CATG 5 cut(s) 48, 114, 118, 180, 292
HspAI GCGC 1 cut(s) 128
KasI GGCGCC 1 cut(s) 127
Ksp22I TGATCA 1 cut(s) 30
Kzo9I GATC 4 cut(s) 30, 79, 160, 292
LpnPI CCDG 8 cut(s) 80, 110, 177, 183, 263, 417, 423, 452
Lsp1109I GCAGC 4 cut(s) 328, 428, 458, 473
MaeII ACGT 2 cut(s) 74, 336
MaeIII GTNAC 1 cut(s) 209
MalI GATC 4 cut(s) 32, 81, 162, 294
MboI GATC 4 cut(s) 30, 79, 160, 292
MboII GAAGA 3 cut(s) 271, 366, 375
MflI RGATCY 2 cut(s) 79, 292
Mly113I GGCGCC 1 cut(s) 128
MmeI TCCRAC 1 cut(s) 57
MnlI CCTC 4 cut(s) 82, 186, 430, 460
Mph1103I ATGCAT 2 cut(s) 116, 227
MseI TTAA 1 cut(s) 487
MslI CAYNNNNRTG 1 cut(s) 109
MwoI GCNNNNNNNGC 2 cut(s) 47, 413
NarI GGCGCC 1 cut(s) 128
NcoI CCATGG 1 cut(s) 288
NdeII GATC 4 cut(s) 30, 79, 160, 292
NlaIII CATG 5 cut(s) 48, 114, 118, 180, 292
NlaIV GGNNCC 2 cut(s) 102, 129
NmuCI GTSAC 1 cut(s) 209
NsiI ATGCAT 2 cut(s) 116, 227
NspI RCATGY 2 cut(s) 118, 180
PaeI GCATGC 1 cut(s) 118
PciI ACATGT 1 cut(s) 176
PcsI WCGNNNNNNNCGW 1 cut(s) 240
PkrI GCNGC 5 cut(s) 318, 418, 448, 463, 481
PluTI GGCGCC 1 cut(s) 131
PscI ACATGT 1 cut(s) 176
PspN4I GGNNCC 2 cut(s) 102, 129
PspPI GGNCC 1 cut(s) 101
PstNI CAGNNNCTG 1 cut(s) 124
PsuI RGATCY 2 cut(s) 79, 292
RseI CAYNNNNRTG 1 cut(s) 109
SalI GTCGAC 1 cut(s) 338
SaqAI TTAA 1 cut(s) 487
SatI GCNGC 5 cut(s) 317, 417, 447, 462, 480
Sau3AI GATC 4 cut(s) 30, 79, 160, 292
Sau96I GGNCC 1 cut(s) 101
SetI ASST 5 cut(s) 77, 267, 339, 409, 466
SfoI GGCGCC 1 cut(s) 129
SinI GGWCC 1 cut(s) 101
SmiMI CAYNNNNRTG 1 cut(s) 109
SphI GCATGC 1 cut(s) 118
SsiI CCGC 4 cut(s) 50, 312, 389, 401
SspDI GGCGCC 1 cut(s) 127
StyI CCWWGG 1 cut(s) 288
TaaI ACNGT 2 cut(s) 189, 344
TaiI ACGT 2 cut(s) 77, 339
TaqI TCGA 1 cut(s) 339
Tru1I TTAA 1 cut(s) 487
Tru9I TTAA 1 cut(s) 487
TseFI GTSAC 1 cut(s) 209
TseI GCWGC 5 cut(s) 316, 416, 446, 461, 479
Tsp45I GTSAC 1 cut(s) 209
TspDTI ATGAA 2 cut(s) 33, 445
VpaK11BI GGWCC 1 cut(s) 101
XceI RCATGY 2 cut(s) 118, 180
XmiI GTMKAC 1 cut(s) 339
ZraI GACGTC 1 cut(s) 337
Zsp2I ATGCAT 2 cut(s) 116, 227
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.