MD01G1208000.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr01
Physical Location & Seq
Reverse (-)
30278613 .. 30280284
1672 bp
Loading structure...
UTR
Exon/CDS
Intron
MD01G1208000.v1.1.491

Sequence Viewer

Length: 168 bp
ATGCTCAAGATGGGTAAATGCAAGGGTTGTGGGAAACTAGGAAGAATGATGCCGAGGGGTGGCTCTGTGAGTGCATATCAGTTTTCCCTTCTGTTGTCACCTGTTGTTTCCGTGTGGGATTGCATCGTTCGCAAAATGAGGTACTCCTATAGACCTGAGTGGGTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

56

Amino Acids

6.29

Weight (kDa)

10.04

Isoelectric Point (pI)

25.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 143
AfiI CCNNNNNNNGG 1 cut(s) 59
AsuHPI GGTGA 1 cut(s) 90
BccI CCATC 1 cut(s) 4
BfaI CTAG 1 cut(s) 38
BfmI CTRYAG 1 cut(s) 148
BmsI GCATC 2 cut(s) 39, 132
BsaJI CCNNGG 1 cut(s) 53
Bsc4I CCNNNNNNNGG 1 cut(s) 59
BseDI CCNNGG 1 cut(s) 53
BseLI CCNNNNNNNGG 1 cut(s) 59
BseMII CTCAG 1 cut(s) 147
BslI CCNNNNNNNGG 1 cut(s) 59
BspCNI CTCAG 1 cut(s) 148
BssECI CCNNGG 1 cut(s) 53
BstDEI CTNAG 1 cut(s) 156
BstMWI GCNNNNNNNGC 1 cut(s) 129
BstSFI CTRYAG 1 cut(s) 148
Csp6I GTAC 1 cut(s) 142
CspCI CAANNNNNGTGG 2 cut(s) 10, 45
CviJI RGCY 1 cut(s) 63
CviKI_1 RGCY 1 cut(s) 63
CviQI GTAC 1 cut(s) 142
DdeI CTNAG 1 cut(s) 156
FaiI YATR 2 cut(s) 76, 150
FspBI CTAG 1 cut(s) 38
HphI GGTGA 1 cut(s) 90
Hpy188III TCNNGA 1 cut(s) 7
HpyAV CCTTC 1 cut(s) 98
HpyCH4V TGCA 3 cut(s) 21, 74, 123
HpyF10VI GCNNNNNNNGC 1 cut(s) 129
HpyF3I CTNAG 1 cut(s) 156
LpnPI CCDG 1 cut(s) 114
LweI GCATC 2 cut(s) 39, 132
MaeI CTAG 1 cut(s) 38
MaeIII GTNAC 1 cut(s) 96
MboII GAAGA 1 cut(s) 54
MnlI CCTC 2 cut(s) 48, 132
MwoI GCNNNNNNNGC 1 cut(s) 129
NmeAIII GCCGAG 1 cut(s) 78
NmuCI GTSAC 1 cut(s) 96
RsaI GTAC 1 cut(s) 143
RsaNI GTAC 1 cut(s) 142
SetI ASST 3 cut(s) 103, 143, 157
SfaNI GCATC 2 cut(s) 39, 132
SfcI CTRYAG 1 cut(s) 148
SgeI CNNG 6 cut(s) 19, 34, 50, 66, 113, 124
SmlI CTYRAG 1 cut(s) 5
SmoI CTYRAG 1 cut(s) 5
SspMI CTAG 1 cut(s) 38
TseFI GTSAC 1 cut(s) 96
Tsp45I GTSAC 1 cut(s) 96
TspGWI ACGGA 1 cut(s) 100
XspI CTAG 1 cut(s) 38
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.