MD07G1278600.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr07
Physical Location & Seq
Reverse (-)
34327785 .. 34329504
1720 bp
Loading structure...
UTR
Exon/CDS
Intron
MD07G1278600.v1.1.491

Sequence Viewer

Length: 186 bp
ATGATCAGTTCCTCTGGTATGCTCAAGATGGGTGAATGCAAGGGTTGTGGGAAATTAGGAAGAATGATGCCGAGGGGTGGATCTGTGAGTGCATATCGGTTTTCCCTTCGGTTGTCTCCTGTTGTTTCCGTTTGGGATTGCATCATTCGCAAAATGAGGTACTCTTACGGACCTGAGTGGGTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

6.84

Weight (kDa)

9.94

Isoelectric Point (pI)

39.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 88
AfaI GTAC 1 cut(s) 161
AfiI CCNNNNNNNGG 1 cut(s) 77
Alw26I GTCTC 1 cut(s) 120
AlwI GGATC 1 cut(s) 88
AspS9I GGNCC 1 cut(s) 170
AsuHPI GGTGA 1 cut(s) 44
AvaII GGWCC 1 cut(s) 170
BccI CCATC 1 cut(s) 22
BclI TGATCA 1 cut(s) 3
BcoDI GTCTC 1 cut(s) 120
Bme18I GGWCC 1 cut(s) 170
BmgT120I GGNCC 1 cut(s) 170
BmsI GCATC 2 cut(s) 57, 150
BpuEI CTTGAG 1 cut(s) 8
BsaJI CCNNGG 1 cut(s) 71
Bsc4I CCNNNNNNNGG 1 cut(s) 77
BseDI CCNNGG 1 cut(s) 71
BseLI CCNNNNNNNGG 1 cut(s) 77
BseMII CTCAG 1 cut(s) 165
BslI CCNNNNNNNGG 1 cut(s) 77
BsmAI GTCTC 1 cut(s) 120
BsmI GAATGC 1 cut(s) 41
Bsp143I GATC 2 cut(s) 3, 80
BspCNI CTCAG 1 cut(s) 166
BspPI GGATC 1 cut(s) 88
BssECI CCNNGG 1 cut(s) 71
BssMI GATC 2 cut(s) 3, 80
BstDEI CTNAG 1 cut(s) 174
BstKTI GATC 2 cut(s) 6, 83
BstMAI GTCTC 1 cut(s) 120
BstMBI GATC 2 cut(s) 3, 80
BstMWI GCNNNNNNNGC 1 cut(s) 147
BstX2I RGATCY 1 cut(s) 80
BstYI RGATCY 1 cut(s) 80
Cfr13I GGNCC 1 cut(s) 170
Csp6I GTAC 1 cut(s) 160
CspCI CAANNNNNGTGG 2 cut(s) 28, 63
CviQI GTAC 1 cut(s) 160
DdeI CTNAG 1 cut(s) 174
DpnI GATC 2 cut(s) 5, 82
DpnII GATC 2 cut(s) 3, 80
Eco47I GGWCC 1 cut(s) 170
FaiI YATR 2 cut(s) 20, 94
FbaI TGATCA 1 cut(s) 3
HphI GGTGA 1 cut(s) 44
Hpy188III TCNNGA 1 cut(s) 25
HpyAV CCTTC 1 cut(s) 116
HpyCH4V TGCA 3 cut(s) 39, 92, 141
HpyF10VI GCNNNNNNNGC 1 cut(s) 147
HpyF3I CTNAG 1 cut(s) 174
Ksp22I TGATCA 1 cut(s) 3
Kzo9I GATC 2 cut(s) 3, 80
LpnPI CCDG 1 cut(s) 132
LweI GCATC 2 cut(s) 57, 150
MalI GATC 2 cut(s) 5, 82
MboI GATC 2 cut(s) 3, 80
MboII GAAGA 1 cut(s) 72
MflI RGATCY 1 cut(s) 80
MluCI AATT 1 cut(s) 53
MnlI CCTC 3 cut(s) 22, 66, 150
Mva1269I GAATGC 1 cut(s) 41
MwoI GCNNNNNNNGC 1 cut(s) 147
NdeII GATC 2 cut(s) 3, 80
NmeAIII GCCGAG 1 cut(s) 96
PctI GAATGC 1 cut(s) 41
PspPI GGNCC 1 cut(s) 170
PsuI RGATCY 1 cut(s) 80
RsaI GTAC 1 cut(s) 161
RsaNI GTAC 1 cut(s) 160
Sau3AI GATC 2 cut(s) 3, 80
Sau96I GGNCC 1 cut(s) 170
SetI ASST 2 cut(s) 161, 175
SfaNI GCATC 2 cut(s) 57, 150
SgeI CNNG 5 cut(s) 27, 37, 52, 84, 131
SinI GGWCC 1 cut(s) 170
SmlI CTYRAG 1 cut(s) 23
SmoI CTYRAG 1 cut(s) 23
Sse9I AATT 1 cut(s) 53
TasI AATT 1 cut(s) 53
TspGWI ACGGA 2 cut(s) 118, 183
VpaK11BI GGWCC 1 cut(s) 170
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.