Prupe.2G300500_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp02
Physical Location & Seq
Reverse (-)
28894175 .. 28894333
159 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.2G300500.1

Sequence Viewer

Length: 159 bp
ATGGGTAAATGCAAAGGTTGTGGGAAATTAGGAAGAATGATGCCAAGGGGTGGATCTGTGAGTGCATATCAATTTTCCCTTCTGTTGTCGCCTGTTGTTTCTGTCTGGGATTGCATCGTTCGCAAAATGAGGTACTCCTACAGACCTGAGTGGGTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

53

Amino Acids

5.92

Weight (kDa)

9.94

Isoelectric Point (pI)

22.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 50
AclWI GGATC 1 cut(s) 61
AfaI GTAC 1 cut(s) 134
AfiI CCNNNNNNNGG 1 cut(s) 50
AlwI GGATC 1 cut(s) 61
BfmI CTRYAG 1 cut(s) 139
BmsI GCATC 2 cut(s) 30, 123
BsaJI CCNNGG 1 cut(s) 44
Bsc4I CCNNNNNNNGG 1 cut(s) 50
BseDI CCNNGG 1 cut(s) 44
BseLI CCNNNNNNNGG 1 cut(s) 50
BseMII CTCAG 1 cut(s) 138
BslI CCNNNNNNNGG 1 cut(s) 50
Bsp143I GATC 1 cut(s) 53
BspCNI CTCAG 1 cut(s) 139
BspPI GGATC 1 cut(s) 61
BssECI CCNNGG 1 cut(s) 44
BssMI GATC 1 cut(s) 53
BssT1I CCWWGG 1 cut(s) 44
BstDEI CTNAG 1 cut(s) 147
BstKTI GATC 1 cut(s) 56
BstMBI GATC 1 cut(s) 53
BstMWI GCNNNNNNNGC 1 cut(s) 120
BstSFI CTRYAG 1 cut(s) 139
BstX2I RGATCY 1 cut(s) 53
BstYI RGATCY 1 cut(s) 53
Csp6I GTAC 1 cut(s) 133
CspCI CAANNNNNGTGG 1 cut(s) 36
CviQI GTAC 1 cut(s) 133
DdeI CTNAG 1 cut(s) 147
DpnI GATC 1 cut(s) 55
DpnII GATC 1 cut(s) 53
Eco130I CCWWGG 1 cut(s) 44
EcoT14I CCWWGG 1 cut(s) 44
ErhI CCWWGG 1 cut(s) 44
FaiI YATR 1 cut(s) 67
HpyAV CCTTC 1 cut(s) 89
HpyCH4V TGCA 3 cut(s) 12, 65, 114
HpyF10VI GCNNNNNNNGC 1 cut(s) 120
HpyF3I CTNAG 1 cut(s) 147
Kzo9I GATC 1 cut(s) 53
LpnPI CCDG 2 cut(s) 91, 105
LweI GCATC 2 cut(s) 30, 123
MalI GATC 1 cut(s) 55
MboI GATC 1 cut(s) 53
MboII GAAGA 1 cut(s) 45
MflI RGATCY 1 cut(s) 53
MluCI AATT 2 cut(s) 26, 71
MnlI CCTC 1 cut(s) 123
MwoI GCNNNNNNNGC 1 cut(s) 120
NdeII GATC 1 cut(s) 53
PflMI CCANNNNNTGG 1 cut(s) 50
PsuI RGATCY 1 cut(s) 53
RsaI GTAC 1 cut(s) 134
RsaNI GTAC 1 cut(s) 133
Sau3AI GATC 1 cut(s) 53
SetI ASST 3 cut(s) 19, 134, 148
SfaNI GCATC 2 cut(s) 30, 123
SfcI CTRYAG 1 cut(s) 139
SgeI CNNG 3 cut(s) 57, 104, 118
Sse9I AATT 2 cut(s) 26, 71
StyI CCWWGG 1 cut(s) 44
TasI AATT 2 cut(s) 26, 71
Van91I CCANNNNNTGG 1 cut(s) 50
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.