Rw1G037510

No description available

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr1
Physical Location & Seq
Reverse (-)
65144785 .. 65144952
168 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw1G037510.1

Sequence Viewer

Length: 168 bp
ATGATCAGCATGGGAAAATGCAAAGGTTGTGGGAAATTAGGAAGAATGATGCCAAGGGGTGGATCAGTGAGCACGTATCAGTTTGCCCTTCTGTTGTCTCCTGTTGTTTCTGTCTGGGATTGCATCGTACGCAAAATGAGGTATTCTTACAGACCTGAGTGGGTGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

55

Amino Acids

6.26

Weight (kDa)

9.94

Isoelectric Point (pI)

21.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 59
AclWI GGATC 1 cut(s) 70
AfaI GTAC 1 cut(s) 129
AfiI CCNNNNNNNGG 1 cut(s) 59
Alw21I GWGCWC 1 cut(s) 74
Alw26I GTCTC 1 cut(s) 102
AlwI GGATC 1 cut(s) 70
Bbv12I GWGCWC 1 cut(s) 74
BclI TGATCA 1 cut(s) 3
BcoDI GTCTC 1 cut(s) 102
BmsI GCATC 2 cut(s) 39, 132
BsaAI YACGTR 1 cut(s) 75
BsaJI CCNNGG 1 cut(s) 53
Bsc4I CCNNNNNNNGG 1 cut(s) 59
BseDI CCNNGG 1 cut(s) 53
BseLI CCNNNNNNNGG 1 cut(s) 59
BseMII CTCAG 1 cut(s) 147
BsiHKAI GWGCWC 1 cut(s) 74
BsiWI CGTACG 1 cut(s) 127
BslI CCNNNNNNNGG 1 cut(s) 59
BsmAI GTCTC 1 cut(s) 102
Bsp1286I GDGCHC 1 cut(s) 74
Bsp143I GATC 2 cut(s) 3, 62
BspCNI CTCAG 1 cut(s) 148
BspPI GGATC 1 cut(s) 70
BssECI CCNNGG 1 cut(s) 53
BssMI GATC 2 cut(s) 3, 62
BssT1I CCWWGG 1 cut(s) 53
BstBAI YACGTR 1 cut(s) 75
BstDEI CTNAG 1 cut(s) 156
BstKTI GATC 2 cut(s) 6, 65
BstMAI GTCTC 1 cut(s) 102
BstMBI GATC 2 cut(s) 3, 62
BstMWI GCNNNNNNNGC 1 cut(s) 129
BtsIMutI CAGTG 1 cut(s) 72
Csp6I GTAC 1 cut(s) 128
CspCI CAANNNNNGTGG 2 cut(s) 10, 45
CviAII CATG 1 cut(s) 10
CviQI GTAC 1 cut(s) 128
DdeI CTNAG 1 cut(s) 156
DpnI GATC 2 cut(s) 5, 64
DpnII GATC 2 cut(s) 3, 62
Eco130I CCWWGG 1 cut(s) 53
EcoT14I CCWWGG 1 cut(s) 53
ErhI CCWWGG 1 cut(s) 53
FaeI CATG 1 cut(s) 13
FaiI YATR 1 cut(s) 11
FatI CATG 1 cut(s) 9
FbaI TGATCA 1 cut(s) 3
Hin1II CATG 1 cut(s) 13
HpyAV CCTTC 1 cut(s) 98
HpyCH4IV ACGT 1 cut(s) 74
HpyCH4V TGCA 2 cut(s) 21, 123
HpyF10VI GCNNNNNNNGC 1 cut(s) 129
HpyF3I CTNAG 1 cut(s) 156
HpySE526I ACGT 1 cut(s) 74
Hsp92II CATG 1 cut(s) 13
Ksp22I TGATCA 1 cut(s) 3
Kzo9I GATC 2 cut(s) 3, 62
LpnPI CCDG 2 cut(s) 100, 114
LweI GCATC 2 cut(s) 39, 132
MaeII ACGT 1 cut(s) 74
MalI GATC 2 cut(s) 5, 64
MboI GATC 2 cut(s) 3, 62
MboII GAAGA 1 cut(s) 54
MhlI GDGCHC 1 cut(s) 74
MluCI AATT 1 cut(s) 35
MnlI CCTC 1 cut(s) 132
MwoI GCNNNNNNNGC 1 cut(s) 129
NdeII GATC 2 cut(s) 3, 62
NlaIII CATG 1 cut(s) 13
Pfl23II CGTACG 1 cut(s) 127
PflMI CCANNNNNTGG 1 cut(s) 59
Ppu21I YACGTR 1 cut(s) 75
PspLI CGTACG 1 cut(s) 127
RsaI GTAC 1 cut(s) 129
RsaNI GTAC 1 cut(s) 128
Sau3AI GATC 2 cut(s) 3, 62
SduI GDGCHC 1 cut(s) 74
SetI ASST 4 cut(s) 28, 77, 143, 157
SfaNI GCATC 2 cut(s) 39, 132
SgeI CNNG 5 cut(s) 22, 66, 85, 113, 127
Sse9I AATT 1 cut(s) 35
StyI CCWWGG 1 cut(s) 53
TaiI ACGT 1 cut(s) 77
TasI AATT 1 cut(s) 35
TscAI CASTG 1 cut(s) 72
TspRI CASTG 1 cut(s) 72
Van91I CCANNNNNTGG 1 cut(s) 59
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.