Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr02

Orthogroup ID

OG0003518

Physical Location & Seq

Genomic Coordinates Forward (+)

5865223 .. 5866237

Gene Structure 1015 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD02G1072000.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 192 bp

ATGGAGATGTTGAAGGTTCAATTCTTTGTGATGGCAGTTTTTGCCCTTGTTATCTCTCTCCTTCTCCCTTCCATCAATGCTCAAAGCCTTGCTCCTGCTCCTGCCCCAACAAGTGATGGGGTGGCTGTGGATCAAGGAATTGCTTATGGGTTGATGGTATTGGCATTGCTTCTCACCTACATTATTCACTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

AGP

Protein Analysis

64

Amino Acids

6.69

Weight (kDa)

4.54

Isoelectric Point (pI)

33.16

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
AGP	PF06376	31 - 63	2.4e-15	Arabinogalactan peptide

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0003518)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G24105
fragaria_vesca	FvH4_1g06710 FvH4_5g03950 FvH4_7g30990
malus_domestica	MD01G1214900.v1.1 MD02G1072000.v1.1 MD07G1284600.v1.1 MD15G1201800.v1.1
prunus_persica	Prupe.2G306800_v2.0.a1 Prupe.5G114400_v2.0.a1 Prupe.7G215700_v2.0.a1
rosa_chinensis	RchiOBHm_Chr1g0380071 RchiOBHm_Chr2g0092451
rosa_laevigata	RLG00000004109
rosa_multiflora	Rmu_sc0001232.1_g000005 Rmu_sc0004184.1_g000003
rosa_roxburghii	Rroxscaffold_2G00149110 Rroxscaffold_3G00260370 Rroxscaffold_4G00279740
rosa_rugosa	Rorug02G0026400 Rorug07G0024100
rosa_samantha	Rh1BG397300 Rh1CG410600 Rh1DG428100 Rh2AG072300 Rh2BG072700 Rh2CG073900 Rh2DG070700 Rh7AG151800 Rh7BG153500 Rh7CG157000 Rh7DG152800
rosa_wichuraiana	Rw1G038400 Rw2G006040 Rw7G012980

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	138
AgsI	TTSAA	2 cut(s)	13, 20
AlwI	GGATC	1 cut(s)	138
AsuHPI	GGTGA	1 cut(s)	166
BccI	CCATC	4 cut(s)	25, 80, 110, 148
Bse3DI	GCAATG	1 cut(s)	164
BseMI	GCAATG	1 cut(s)	164
Bsp143I	GATC	1 cut(s)	130
BspPI	GGATC	1 cut(s)	138
BsrDI	GCAATG	1 cut(s)	164
BssMI	GATC	1 cut(s)	130
BstAPI	GCANNNNNTGC	1 cut(s)	41
BstKTI	GATC	1 cut(s)	133
BstMBI	GATC	1 cut(s)	130
BstMWI	GCNNNNNNNGC	1 cut(s)	41
BtsIMutI	CAGTG	1 cut(s)	187
CviJI	RGCY	2 cut(s)	87, 125
CviKI_1	RGCY	2 cut(s)	87, 125
DpnI	GATC	1 cut(s)	132
DpnII	GATC	1 cut(s)	130
FaiI	YATR	1 cut(s)	147
HphI	GGTGA	1 cut(s)	166
HpyAV	CCTTC	3 cut(s)	7, 71, 78
HpyF10VI	GCNNNNNNNGC	1 cut(s)	41
Kzo9I	GATC	1 cut(s)	130
LmnI	GCTCC	2 cut(s)	97, 103
LpnPI	CCDG	2 cut(s)	108, 114
MalI	GATC	1 cut(s)	132
MboI	GATC	1 cut(s)	130
MluCI	AATT	2 cut(s)	20, 138
MwoI	GCNNNNNNNGC	1 cut(s)	41
NdeII	GATC	1 cut(s)	130
Sau3AI	GATC	1 cut(s)	130
SetI	ASST	2 cut(s)	18, 179
SgeI	CNNG	6 cut(s)	59, 101, 107, 113, 123, 146
Sse9I	AATT	2 cut(s)	20, 138
TasI	AATT	2 cut(s)	20, 138

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.