Prupe.7G215700_v2.0.a1

Arabinogalactan peptide

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp07
Physical Location & Seq
Reverse (-)
19521773 .. 19522749
977 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.7G215700.1

Sequence Viewer

Length: 192 bp
ATGGAGATGTTGAAAGTTCAATTTTTTGTGATGGCAATTTGTTCCCTTGTTATCTCTCTGCTTCTCCCCTCCATCAATGCTCAAACCCTTGCACCTACCCCTGCCCCTACAAGTGATGGGGTAGCAGTGGACCAAGGAATTGCTTATGTGCTGATGGTATTGGCTCTGCTCCTCACCTACATCATCCATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

64

Amino Acids

6.76

Weight (kDa)

4.54

Isoelectric Point (pI)

21.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 13, 20
AspS9I GGNCC 1 cut(s) 130
AsuHPI GGTGA 1 cut(s) 166
AvaII GGWCC 1 cut(s) 130
BccI CCATC 4 cut(s) 25, 80, 110, 148
Bme18I GGWCC 1 cut(s) 130
BmgT120I GGNCC 1 cut(s) 130
BsaJI CCNNGG 1 cut(s) 133
BseDI CCNNGG 1 cut(s) 133
BseGI GGATG 1 cut(s) 183
BseRI GAGGAG 1 cut(s) 161
BssECI CCNNGG 1 cut(s) 133
BssT1I CCWWGG 1 cut(s) 133
BstF5I GGATG 1 cut(s) 183
BtsCI GGATG 1 cut(s) 183
BtsI GCAGTG 1 cut(s) 132
BtsIMutI CAGTG 1 cut(s) 132
Cfr13I GGNCC 1 cut(s) 130
CviJI RGCY 1 cut(s) 164
CviKI_1 RGCY 1 cut(s) 164
Eco130I CCWWGG 1 cut(s) 133
Eco47I GGWCC 1 cut(s) 130
EcoT14I CCWWGG 1 cut(s) 133
ErhI CCWWGG 1 cut(s) 133
FaiI YATR 1 cut(s) 147
FokI GGATG 1 cut(s) 170
HphI GGTGA 1 cut(s) 166
Hpy166II GTNNAC 1 cut(s) 130
Hpy8I GTNNAC 1 cut(s) 130
HpyCH4V TGCA 1 cut(s) 92
LmnI GCTCC 1 cut(s) 174
LpnPI CCDG 1 cut(s) 114
MluCI AATT 3 cut(s) 20, 36, 138
MnlI CCTC 2 cut(s) 79, 182
PspPI GGNCC 1 cut(s) 130
Sau96I GGNCC 1 cut(s) 130
SetI ASST 2 cut(s) 97, 179
SgeI CNNG 5 cut(s) 59, 101, 113, 123, 146
SinI GGWCC 1 cut(s) 130
Sse9I AATT 3 cut(s) 20, 36, 138
StyI CCWWGG 1 cut(s) 133
TasI AATT 3 cut(s) 20, 36, 138
TscAI CASTG 1 cut(s) 132
TspRI CASTG 1 cut(s) 132
VpaK11BI GGWCC 1 cut(s) 130
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.