Rh2BG072700

Arabinogalactan peptide

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
Physical Location & Seq
Forward (+)
5532109 .. 5532543
435 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG072700.1

Sequence Viewer

Length: 165 bp
ATGGCGATTCTCTCTGCAGTCATCATTTCTCTTCTACTACCTTCCATCAATGCTCAGAGCCTCGCACCAGCTCCCGCCCCCACGAGTGATGGGGTAGCAGTTGATCAAGGAATTGCATATGCCCTAATGGCATTTGCTCTGGTGCTCACCTATATCATTCACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

54

Amino Acids

5.51

Weight (kDa)

4.2

Isoelectric Point (pI)

53.37

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
AGP PF06376 22 - 54 7.9e-16 Arabinogalactan peptide
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 75
AluBI AGCT 1 cut(s) 71
AluI AGCT 1 cut(s) 71
Alw21I GWGCWC 1 cut(s) 147
AsuHPI GGTGA 1 cut(s) 139
BauI CACGAG 1 cut(s) 82
Bbv12I GWGCWC 1 cut(s) 147
BccI CCATC 2 cut(s) 53, 83
BclI TGATCA 1 cut(s) 103
BfmI CTRYAG 1 cut(s) 15
BglI GCCNNNNNGGC 1 cut(s) 128
BseMII CTCAG 1 cut(s) 68
BsiHKAI GWGCWC 1 cut(s) 147
Bsp1286I GDGCHC 1 cut(s) 147
Bsp143I GATC 1 cut(s) 103
BspACI CCGC 1 cut(s) 75
BspCNI CTCAG 1 cut(s) 67
BspMAI CTGCAG 1 cut(s) 19
BssMI GATC 1 cut(s) 103
BssSI CACGAG 1 cut(s) 82
Bst2BI CACGAG 1 cut(s) 82
Bst6I CTCTTC 1 cut(s) 36
BstDEI CTNAG 1 cut(s) 54
BstKTI GATC 1 cut(s) 106
BstMBI GATC 1 cut(s) 103
BstMWI GCNNNNNNNGC 1 cut(s) 128
BstSFI CTRYAG 1 cut(s) 15
BtsIMutI CAGTG 1 cut(s) 160
CviJI RGCY 2 cut(s) 60, 71
CviKI_1 RGCY 2 cut(s) 60, 71
DdeI CTNAG 1 cut(s) 54
DpnI GATC 1 cut(s) 105
DpnII GATC 1 cut(s) 103
Eam1104I CTCTTC 1 cut(s) 36
EarI CTCTTC 1 cut(s) 36
FaiI YATR 3 cut(s) 118, 120, 153
FauI CCCGC 1 cut(s) 82
FauNDI CATATG 1 cut(s) 118
FbaI TGATCA 1 cut(s) 103
HinfI GANTC 1 cut(s) 7
HphI GGTGA 1 cut(s) 139
Hpy188I TCNGA 1 cut(s) 57
HpyAV CCTTC 1 cut(s) 51
HpyCH4V TGCA 2 cut(s) 17, 116
HpyF10VI GCNNNNNNNGC 1 cut(s) 128
HpyF3I CTNAG 1 cut(s) 54
Ksp22I TGATCA 1 cut(s) 103
Kzo9I GATC 1 cut(s) 103
LmnI GCTCC 1 cut(s) 76
LpnPI CCDG 2 cut(s) 81, 125
MalI GATC 1 cut(s) 105
MboI GATC 1 cut(s) 103
MboII GAAGA 1 cut(s) 23
MhlI GDGCHC 1 cut(s) 147
MluCI AATT 1 cut(s) 111
MnlI CCTC 1 cut(s) 71
MwoI GCNNNNNNNGC 1 cut(s) 128
NdeI CATATG 1 cut(s) 118
NdeII GATC 1 cut(s) 103
PfeI GAWTC 1 cut(s) 7
PstI CTGCAG 1 cut(s) 19
Sau3AI GATC 1 cut(s) 103
SduI GDGCHC 1 cut(s) 147
SetI ASST 3 cut(s) 43, 73, 152
SfcI CTRYAG 1 cut(s) 15
SgeI CNNG 7 cut(s) 74, 80, 86, 94, 96, 119, 152
Sse9I AATT 1 cut(s) 111
SsiI CCGC 1 cut(s) 75
TasI AATT 1 cut(s) 111
TfiI GAWTC 1 cut(s) 7
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.