MD02G1286600.v1.1

Belongs to the helicase family

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr02
Physical Location & Seq
Reverse (-)
34325786 .. 34326498
713 bp
Loading structure...
UTR
Exon/CDS
Intron
MD02G1286600.v1.1.491

Sequence Viewer

Length: 150 bp
ATGATACGGCGTAGCTTACTTCTGGTGAAGGATGGTTGGAGCAGGCAGCATATGATAGAAATTTTCTTGATAACAACTCTGAACCAAGCTGGCAAGCAAGTACGGGCGAGGAGGAGGCTGATGATCCTTCTTCAGTGGGGCACGTTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

50

Amino Acids

5.86

Weight (kDa)

12.0

Isoelectric Point (pI)

83.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 118
AcsI RAATTY 1 cut(s) 60
AcuI CTGAAG 1 cut(s) 116
AdeI CACNNNGTG 1 cut(s) 147
AfaI GTAC 1 cut(s) 102
AluBI AGCT 2 cut(s) 15, 89
AluI AGCT 2 cut(s) 15, 89
AlwI GGATC 1 cut(s) 118
ApeKI GCWGC 1 cut(s) 46
ApoI RAATTY 1 cut(s) 60
AsuHPI GGTGA 1 cut(s) 37
BaeGI GKGCMC 1 cut(s) 143
BbvI GCAGC 1 cut(s) 58
BccI CCATC 1 cut(s) 26
BceAI ACGGC 1 cut(s) 23
BisI GCNGC 1 cut(s) 47
BlsI GCNGC 1 cut(s) 48
BseGI GGATG 1 cut(s) 37
BseRI GAGGAG 2 cut(s) 124, 127
BseSI GKGCMC 1 cut(s) 143
BseXI GCAGC 1 cut(s) 58
Bsp1286I GDGCHC 1 cut(s) 143
Bsp143I GATC 1 cut(s) 123
BspPI GGATC 1 cut(s) 118
BssMI GATC 1 cut(s) 123
BstC8I GCNNGC 3 cut(s) 44, 91, 95
BstF5I GGATG 1 cut(s) 37
BstKTI GATC 1 cut(s) 126
BstMBI GATC 1 cut(s) 123
BstSLI GKGCMC 1 cut(s) 143
BstV1I GCAGC 1 cut(s) 58
BtsCI GGATG 1 cut(s) 37
BtsIMutI CAGTG 1 cut(s) 140
Cac8I GCNNGC 3 cut(s) 44, 91, 95
Csp6I GTAC 1 cut(s) 101
CviJI RGCY 3 cut(s) 15, 89, 118
CviKI_1 RGCY 3 cut(s) 15, 89, 118
CviQI GTAC 1 cut(s) 101
DpnI GATC 1 cut(s) 125
DpnII GATC 1 cut(s) 123
DraIII CACNNNGTG 1 cut(s) 147
Eco57I CTGAAG 1 cut(s) 116
FaiI YATR 2 cut(s) 51, 53
FauNDI CATATG 1 cut(s) 51
Fnu4HI GCNGC 1 cut(s) 47
FokI GGATG 1 cut(s) 44
Fsp4HI GCNGC 1 cut(s) 47
GluI GCNGC 1 cut(s) 47
HphI GGTGA 1 cut(s) 37
Hpy188I TCNGA 1 cut(s) 81
Hpy188III TCNNGA 1 cut(s) 67
HpyAV CCTTC 2 cut(s) 22, 137
HpyCH4IV ACGT 1 cut(s) 143
HpySE526I ACGT 1 cut(s) 143
Kzo9I GATC 1 cut(s) 123
LmnI GCTCC 1 cut(s) 39
LpnPI CCDG 3 cut(s) 8, 28, 75
Lsp1109I GCAGC 1 cut(s) 58
MaeII ACGT 1 cut(s) 143
MalI GATC 1 cut(s) 125
MboI GATC 1 cut(s) 123
MboII GAAGA 1 cut(s) 122
MhlI GDGCHC 1 cut(s) 143
MluCI AATT 1 cut(s) 60
MmeI TCCRAC 1 cut(s) 17
MnlI CCTC 3 cut(s) 102, 105, 108
NdeI CATATG 1 cut(s) 51
NdeII GATC 1 cut(s) 123
PkrI GCNGC 1 cut(s) 48
RsaI GTAC 1 cut(s) 102
RsaNI GTAC 1 cut(s) 101
SatI GCNGC 1 cut(s) 47
Sau3AI GATC 1 cut(s) 123
SduI GDGCHC 1 cut(s) 143
SetI ASST 3 cut(s) 17, 91, 146
SgeI CNNG 9 cut(s) 35, 55, 79, 98, 102, 106, 110, 116, 120
Sse9I AATT 1 cut(s) 60
TaiI ACGT 1 cut(s) 146
TasI AATT 1 cut(s) 60
TscAI CASTG 1 cut(s) 140
TseI GCWGC 1 cut(s) 46
TspRI CASTG 1 cut(s) 140
XapI RAATTY 1 cut(s) 60
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.