MD03G1008900.v1.1

K homology RNA-binding domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr03
OG0003736
Physical Location & Seq
Forward (+)
664098 .. 666505
2408 bp
Loading structure...
UTR
Exon/CDS
Intron
MD03G1008900.v1.1.491

Sequence Viewer

Length: 225 bp
ATGAAATTGACAAAAAAGTTGGAACTTGAAAAGCGGGAAGCCATAGCATTGCTTTTTCGGTTGGTTCCTTCCGTACTGGTGTTGATGAAGGAATATCCTAAATACAATTTTGTTGGCCTGATATATGGTCCTGGAAGTGATAACCAGAAACAATTAGAAAAGGAAACTGGAGCCAAAATTCAAGTCTATGGTACCAAAGCTGGGACAGGACATAAGGCTAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
KH_1 SF1-HH

Protein Analysis

75

Amino Acids

8.31

Weight (kDa)

9.78

Isoelectric Point (pI)

9.83

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
KH-I_KHDC4-BBP PF22675 31 - 69 4.2e-09 KHDC4/BBP-like, KH-domain type I
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 191
AccB1I GGYRCC 1 cut(s) 191
AciI CCGC 1 cut(s) 34
AcsI RAATTY 1 cut(s) 177
AfaI GTAC 2 cut(s) 75, 193
AfiI CCNNNNNNNGG 1 cut(s) 201
AgsI TTSAA 2 cut(s) 29, 182
AjnI CCWGG 1 cut(s) 130
AluBI AGCT 1 cut(s) 200
AluI AGCT 1 cut(s) 200
AoxI GGCC 1 cut(s) 115
ApoI RAATTY 1 cut(s) 177
ArsI GACNNNNNNTTYG 2 cut(s) 168, 200
Asp718I GGTACC 1 cut(s) 191
AspS9I GGNCC 1 cut(s) 128
AvaII GGWCC 1 cut(s) 128
BanI GGYRCC 1 cut(s) 191
BciT130I CCWGG 1 cut(s) 132
Bme1390I CCNGG 1 cut(s) 132
Bme18I GGWCC 1 cut(s) 128
BmgT120I GGNCC 1 cut(s) 128
BmiI GGNNCC 3 cut(s) 66, 172, 193
BmrFI CCNGG 1 cut(s) 132
BpmI CTGGAG 1 cut(s) 189
Bsc4I CCNNNNNNNGG 1 cut(s) 201
Bse1I ACTGG 2 cut(s) 81, 172
Bse3DI GCAATG 1 cut(s) 47
BseBI CCWGG 1 cut(s) 132
BseLI CCNNNNNNNGG 1 cut(s) 201
BseMI GCAATG 1 cut(s) 47
BseNI ACTGG 2 cut(s) 81, 172
BseYI CCCAGC 1 cut(s) 200
BshFI GGCC 1 cut(s) 117
BshNI GGYRCC 1 cut(s) 191
BslFI GGGAC 1 cut(s) 217
BslI CCNNNNNNNGG 1 cut(s) 201
BsmFI GGGAC 1 cut(s) 217
BsnI GGCC 1 cut(s) 117
BspACI CCGC 1 cut(s) 34
BspANI GGCC 1 cut(s) 117
BspLI GGNNCC 3 cut(s) 66, 172, 193
BspT107I GGYRCC 1 cut(s) 191
BsrDI GCAATG 1 cut(s) 47
BsrI ACTGG 2 cut(s) 81, 172
Bst2UI CCWGG 1 cut(s) 132
BstNI CCWGG 1 cut(s) 132
BstSCI CCNGG 1 cut(s) 130
BsuRI GGCC 1 cut(s) 117
Cfr13I GGNCC 1 cut(s) 128
Csp6I GTAC 2 cut(s) 74, 192
CviJI RGCY 5 cut(s) 41, 117, 173, 200, 218
CviKI_1 RGCY 5 cut(s) 41, 117, 173, 200, 218
CviQI GTAC 2 cut(s) 74, 192
Eco47I GGWCC 1 cut(s) 128
EcoRII CCWGG 1 cut(s) 130
FaiI YATR 5 cut(s) 44, 124, 126, 189, 213
FaqI GGGAC 1 cut(s) 217
FauI CCCGC 1 cut(s) 27
GsaI CCCAGC 1 cut(s) 204
GsuI CTGGAG 1 cut(s) 189
HaeIII GGCC 1 cut(s) 117
HpyAV CCTTC 2 cut(s) 78, 82
KpnI GGTACC 1 cut(s) 195
LmnI GCTCC 1 cut(s) 170
LpnPI CCDG 8 cut(s) 62, 117, 131, 144, 153, 158, 186, 192
MluCI AATT 4 cut(s) 5, 106, 152, 177
MspR9I CCNGG 1 cut(s) 132
MvaI CCWGG 1 cut(s) 132
NlaIV GGNNCC 3 cut(s) 66, 172, 193
PfoI TCCNGGA 1 cut(s) 130
Psp6I CCWGG 1 cut(s) 130
PspFI CCCAGC 1 cut(s) 200
PspGI CCWGG 1 cut(s) 130
PspN4I GGNNCC 3 cut(s) 66, 172, 193
PspPI GGNCC 1 cut(s) 128
RsaI GTAC 2 cut(s) 75, 193
RsaNI GTAC 2 cut(s) 74, 192
Sau96I GGNCC 1 cut(s) 128
ScrFI CCNGG 1 cut(s) 132
SetI ASST 1 cut(s) 202
SinI GGWCC 1 cut(s) 128
Sse9I AATT 4 cut(s) 5, 106, 152, 177
SsiI CCGC 1 cut(s) 34
StyD4I CCNGG 1 cut(s) 130
TasI AATT 4 cut(s) 5, 106, 152, 177
TspDTI ATGAA 2 cut(s) 17, 101
TspGWI ACGGA 1 cut(s) 61
VpaK11BI GGWCC 1 cut(s) 128
XapI RAATTY 1 cut(s) 177
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.