pycom11g00730

K homology RNA-binding domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr11
OG0003736
Physical Location & Seq
Forward (+)
535006 .. 535206
201 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom11g00730.1

Sequence Viewer

Length: 201 bp
ATGGGCAGTTTCAGTACCCTGGTCCATTTTTTCTTGACGGGCGCATCTTCCGCTCCTGTGAATATGCCTGGCTTCAATCCGCTGAATTCTTCAAGACCAATTCTCAACAATCCATCCCGACCAATTCTCAACAGTCCATCCCATCTGTCAACATCACCTTTCAACCCCACAGACCTGCCTTCATCATTTGGGCTTCCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
KH_1 SF1-HH

Protein Analysis

67

Amino Acids

6.97

Weight (kDa)

9.39

Isoelectric Point (pI)

73.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 183
AccBSI CCGCTC 1 cut(s) 53
AciI CCGC 2 cut(s) 51, 80
AcsI RAATTY 1 cut(s) 85
AfaI GTAC 1 cut(s) 16
AgsI TTSAA 3 cut(s) 76, 93, 163
AjnI CCWGG 2 cut(s) 18, 67
ApoI RAATTY 1 cut(s) 85
AspLEI GCGC 1 cut(s) 44
AspS9I GGNCC 1 cut(s) 22
AsuHPI GGTGA 1 cut(s) 147
AvaII GGWCC 1 cut(s) 22
BccI CCATC 3 cut(s) 121, 145, 150
BciT130I CCWGG 2 cut(s) 20, 69
BfuAI ACCTGC 1 cut(s) 183
Bme1390I CCNGG 2 cut(s) 20, 69
Bme18I GGWCC 1 cut(s) 22
BmgT120I GGNCC 1 cut(s) 22
BmrFI CCNGG 2 cut(s) 20, 69
BmsI GCATC 1 cut(s) 53
BsaJI CCNNGG 1 cut(s) 18
BseBI CCWGG 2 cut(s) 20, 69
BseDI CCNNGG 1 cut(s) 18
BseGI GGATG 2 cut(s) 113, 137
BspACI CCGC 2 cut(s) 51, 80
BspMI ACCTGC 1 cut(s) 183
BsrBI CCGCTC 1 cut(s) 53
BssECI CCNNGG 1 cut(s) 18
Bst2UI CCWGG 2 cut(s) 20, 69
Bst4CI ACNGT 1 cut(s) 134
BstF5I GGATG 2 cut(s) 113, 137
BstHHI GCGC 1 cut(s) 44
BstMWI GCNNNNNNNGC 1 cut(s) 50
BstNI CCWGG 2 cut(s) 20, 69
BstSCI CCNGG 2 cut(s) 18, 67
BtsCI GGATG 2 cut(s) 113, 137
BveI ACCTGC 1 cut(s) 183
CfoI GCGC 1 cut(s) 44
Cfr13I GGNCC 1 cut(s) 22
Csp6I GTAC 1 cut(s) 15
CviJI RGCY 2 cut(s) 72, 193
CviKI_1 RGCY 2 cut(s) 72, 193
CviQI GTAC 1 cut(s) 15
Eco47I GGWCC 1 cut(s) 22
EcoRI GAATTC 1 cut(s) 85
EcoRII CCWGG 2 cut(s) 18, 67
FaiI YATR 1 cut(s) 65
FokI GGATG 2 cut(s) 100, 124
GlaI GCGC 1 cut(s) 43
HhaI GCGC 1 cut(s) 44
Hin6I GCGC 1 cut(s) 42
HinP1I GCGC 1 cut(s) 42
HincII GTYRAC 1 cut(s) 150
HindII GTYRAC 1 cut(s) 150
HphI GGTGA 1 cut(s) 147
Hpy166II GTNNAC 1 cut(s) 150
Hpy188III TCNNGA 3 cut(s) 34, 93, 117
Hpy8I GTNNAC 1 cut(s) 150
HpyAV CCTTC 1 cut(s) 189
HpyCH4III ACNGT 1 cut(s) 134
HpyF10VI GCNNNNNNNGC 1 cut(s) 50
HspAI GCGC 1 cut(s) 42
LmnI GCTCC 1 cut(s) 58
LpnPI CCDG 6 cut(s) 5, 32, 54, 69, 81, 188
LweI GCATC 1 cut(s) 53
MbiI CCGCTC 1 cut(s) 53
MboII GAAGA 2 cut(s) 39, 81
MluCI AATT 3 cut(s) 85, 99, 123
MspA1I CMGCKG 1 cut(s) 82
MspR9I CCNGG 2 cut(s) 20, 69
MvaI CCWGG 2 cut(s) 20, 69
MwoI GCNNNNNNNGC 1 cut(s) 50
Psp6I CCWGG 2 cut(s) 18, 67
PspGI CCWGG 2 cut(s) 18, 67
PspPI GGNCC 1 cut(s) 22
RsaI GTAC 1 cut(s) 16
RsaNI GTAC 1 cut(s) 15
Sau96I GGNCC 1 cut(s) 22
ScrFI CCNGG 2 cut(s) 20, 69
SetI ASST 2 cut(s) 160, 177
SfaNI GCATC 1 cut(s) 53
SinI GGWCC 1 cut(s) 22
Sse9I AATT 3 cut(s) 85, 99, 123
SsiI CCGC 2 cut(s) 51, 80
StyD4I CCNGG 2 cut(s) 18, 67
TaaI ACNGT 1 cut(s) 134
TasI AATT 3 cut(s) 85, 99, 123
TspDTI ATGAA 1 cut(s) 171
VpaK11BI GGWCC 1 cut(s) 22
XapI RAATTY 1 cut(s) 85
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.