MD06G1157100.v1.1

Oxygen-independent coproporphyrinogen-III oxidase-like protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr06
Physical Location & Seq
Forward (+)
29928296 .. 29928508
213 bp
Loading structure...
UTR
Exon/CDS
Intron
MD06G1157100.v1.1.491

Sequence Viewer

Length: 213 bp
ATGCTTAAATCAAGCTTCGCTCCCATTTTCTCAACCTTTCCCGCCAAACGCCTATCTCCGCCGAAGCCACCGCCAGACGCTACCTTCACCTGCTTCGCACACACAGCGCCAAATGTTCGAAAAAATGCCTCAACCAAAGCCCCCACCATTATTCTCCCGCCATCCACTTCCGCCTACATCCACCTCTCTTTCTGCCGACAGCGCTGTCACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

71

Amino Acids

7.7

Weight (kDa)

10.32

Isoelectric Point (pI)

63.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 98
AasI GACNNNNNNGTC 1 cut(s) 204
Acc36I ACCTGC 1 cut(s) 98
AciI CCGC 5 cut(s) 42, 59, 71, 158, 171
AfeI AGCGCT 1 cut(s) 203
AluBI AGCT 1 cut(s) 15
AluI AGCT 1 cut(s) 15
Aor51HI AGCGCT 1 cut(s) 203
AspLEI GCGC 2 cut(s) 109, 204
AsuHPI GGTGA 1 cut(s) 79
AsuII TTCGAA 1 cut(s) 118
BccI CCATC 1 cut(s) 169
BfoI RGCGCY 2 cut(s) 110, 205
BfuAI ACCTGC 1 cut(s) 98
Bpu14I TTCGAA 1 cut(s) 118
BseGI GGATG 2 cut(s) 161, 177
Bsp119I TTCGAA 1 cut(s) 118
BspACI CCGC 5 cut(s) 42, 59, 71, 158, 171
BspMI ACCTGC 1 cut(s) 98
BspT104I TTCGAA 1 cut(s) 118
BstBI TTCGAA 1 cut(s) 118
BstF5I GGATG 2 cut(s) 161, 177
BstH2I RGCGCY 2 cut(s) 110, 205
BstHHI GCGC 2 cut(s) 109, 204
BstMWI GCNNNNNNNGC 2 cut(s) 104, 201
BtsCI GGATG 2 cut(s) 161, 177
BveI ACCTGC 1 cut(s) 98
CfoI GCGC 2 cut(s) 109, 204
CseI GACGC 1 cut(s) 86
CviJI RGCY 3 cut(s) 15, 67, 140
CviKI_1 RGCY 3 cut(s) 15, 67, 140
DrdI GACNNNNNNGTC 1 cut(s) 204
DseDI GACNNNNNNGTC 1 cut(s) 204
EciI GGCGGA 2 cut(s) 48, 160
Eco47III AGCGCT 1 cut(s) 203
FauI CCCGC 2 cut(s) 49, 165
FokI GGATG 2 cut(s) 148, 164
GlaI GCGC 2 cut(s) 108, 203
HaeII RGCGCY 2 cut(s) 110, 205
HgaI GACGC 1 cut(s) 86
HhaI GCGC 2 cut(s) 109, 204
Hin6I GCGC 2 cut(s) 107, 202
HinP1I GCGC 2 cut(s) 107, 202
HindIII AAGCTT 1 cut(s) 13
HphI GGTGA 1 cut(s) 79
HpyAV CCTTC 1 cut(s) 94
HpyF10VI GCNNNNNNNGC 2 cut(s) 104, 201
HspAI GCGC 2 cut(s) 107, 202
LmnI GCTCC 1 cut(s) 25
LpnPI CCDG 2 cut(s) 87, 103
MaeIII GTNAC 1 cut(s) 206
MnlI CCTC 2 cut(s) 139, 194
MseI TTAA 1 cut(s) 6
MwoI GCNNNNNNNGC 2 cut(s) 104, 201
NmuCI GTSAC 1 cut(s) 206
NspV TTCGAA 1 cut(s) 118
PaqCI CACCTGC 1 cut(s) 98
SaqAI TTAA 1 cut(s) 6
SetI ASST 5 cut(s) 17, 38, 86, 92, 186
SfuI TTCGAA 1 cut(s) 118
SgeI CNNG 5 cut(s) 24, 53, 86, 102, 169
SsiI CCGC 5 cut(s) 42, 59, 71, 158, 171
TaqI TCGA 1 cut(s) 118
Tru1I TTAA 1 cut(s) 6
Tru9I TTAA 1 cut(s) 6
TseFI GTSAC 1 cut(s) 206
Tsp45I GTSAC 1 cut(s) 206
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.