Rmu_co8185394.1_g000001

Oxygen-independent coproporphyrinogen-III oxidase-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8185394.1
OG0009349
Physical Location & Seq
Forward (+)
1 .. 501
501 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8185394.1_g000001.1.cds

Sequence Viewer

Length: 501 bp
tatcagtgcaagcacaatcttacttactggaagaacaagcctttctatggttttggcctcggctctgctagccatgttggtggtgtgaggttttcgagaccaaaaatgatgaaagagtacaatggttatgtggagaacttggaaaatgggttggtggattgtggtgggagtaaatatattgatgtcaaggacatggccatggacgttgttatgctctctcttagaacttcaagaggtctggatttgaagtcttttggagaagcgtatggtagctcccttgttgtctctctttgcgaggtttataaaccttatgttgaaagtgggcatgtggttttcttagatgagcagagaagggccatgactgtagatgagttgaactccttcaaactaaacgaagaagagatcgaaaaaagtcttgcatatatccgtctaagtgatccagatggtttccttttatcgaatgaattgatatcacttgcatttgcagttgtatgtccgtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
HemN_C Radical_SAM

Protein Analysis

166

Amino Acids

18.68

Weight (kDa)

5.42

Isoelectric Point (pI)

28.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 303
AclWI GGATC 1 cut(s) 431
AcoI YGGCCR 1 cut(s) 195
AfaI GTAC 1 cut(s) 119
AfiI CCNNNNNNNGG 1 cut(s) 47
AgsI TTSAA 5 cut(s) 231, 247, 317, 376, 385
AluBI AGCT 1 cut(s) 273
AluI AGCT 1 cut(s) 273
Alw26I GTCTC 2 cut(s) 91, 289
AlwI GGATC 1 cut(s) 431
AoxI GGCC 3 cut(s) 55, 195, 354
Asp700I GAANNNNTTC 1 cut(s) 380
AspS9I GGNCC 1 cut(s) 354
AsuNHI GCTAGC 1 cut(s) 68
BalI TGGCCA 1 cut(s) 197
BccI CCATC 1 cut(s) 437
BcoDI GTCTC 2 cut(s) 91, 289
BfaI CTAG 1 cut(s) 69
BfmI CTRYAG 1 cut(s) 363
BmgT120I GGNCC 1 cut(s) 354
BmtI GCTAGC 1 cut(s) 72
BplI GAGNNNNNCTC 2 cut(s) 362, 394
BsaI GGTCTC 1 cut(s) 91
BsaJI CCNNGG 2 cut(s) 58, 198
Bsc4I CCNNNNNNNGG 1 cut(s) 47
Bse1I ACTGG 1 cut(s) 32
BseDI CCNNGG 2 cut(s) 58, 198
BseLI CCNNNNNNNGG 1 cut(s) 47
BseNI ACTGG 1 cut(s) 32
BshFI GGCC 3 cut(s) 57, 197, 356
BslI CCNNNNNNNGG 1 cut(s) 47
BsmAI GTCTC 2 cut(s) 91, 289
BsnI GGCC 3 cut(s) 57, 197, 356
Bso31I GGTCTC 1 cut(s) 91
Bsp143I GATC 2 cut(s) 402, 436
Bsp19I CCATGG 1 cut(s) 198
BspANI GGCC 3 cut(s) 57, 197, 356
BspOI GCTAGC 1 cut(s) 72
BspPI GGATC 1 cut(s) 431
BspTNI GGTCTC 1 cut(s) 91
BsrI ACTGG 1 cut(s) 32
BssECI CCNNGG 2 cut(s) 58, 198
BssMI GATC 2 cut(s) 402, 436
BssT1I CCWWGG 1 cut(s) 198
Bst4CI ACNGT 1 cut(s) 364
Bst6I CTCTTC 1 cut(s) 393
BstC8I GCNNGC 2 cut(s) 11, 70
BstDEI CTNAG 3 cut(s) 221, 337, 431
BstDSI CCRYGG 1 cut(s) 198
BstKTI GATC 2 cut(s) 405, 439
BstMAI GTCTC 2 cut(s) 91, 289
BstMBI GATC 2 cut(s) 402, 436
BstMWI GCNNNNNNNGC 1 cut(s) 69
BstNSI RCATGY 1 cut(s) 329
BstSFI CTRYAG 1 cut(s) 363
BstXI CCANNNNNNTGG 1 cut(s) 80
BsuRI GGCC 3 cut(s) 57, 197, 356
BtgI CCRYGG 1 cut(s) 198
BtsIMutI CAGTG 1 cut(s) 11
Cac8I GCNNGC 2 cut(s) 11, 70
Cfr13I GGNCC 1 cut(s) 354
Csp6I GTAC 1 cut(s) 118
CviAII CATG 5 cut(s) 74, 193, 199, 326, 358
CviJI RGCY 7 cut(s) 40, 57, 63, 72, 197, 273, 356
CviKI_1 RGCY 7 cut(s) 40, 57, 63, 72, 197, 273, 356
CviQI GTAC 1 cut(s) 118
DdeI CTNAG 3 cut(s) 221, 337, 431
DpnI GATC 2 cut(s) 404, 438
DpnII GATC 2 cut(s) 402, 436
EaeI YGGCCR 1 cut(s) 195
Eam1104I CTCTTC 1 cut(s) 393
EarI CTCTTC 1 cut(s) 393
Eco130I CCWWGG 1 cut(s) 198
Eco31I GGTCTC 1 cut(s) 91
Eco32I GATATC 1 cut(s) 471
EcoRV GATATC 1 cut(s) 471
EcoT14I CCWWGG 1 cut(s) 198
ErhI CCWWGG 1 cut(s) 198
FaeI CATG 5 cut(s) 77, 196, 202, 329, 361
FatI CATG 5 cut(s) 73, 192, 198, 325, 357
FspBI CTAG 1 cut(s) 69
HaeIII GGCC 3 cut(s) 57, 197, 356
Hin1II CATG 5 cut(s) 77, 196, 202, 329, 361
Hpy188III TCNNGA 4 cut(s) 96, 231, 239, 440
HpyAV CCTTC 2 cut(s) 345, 391
HpyCH4III ACNGT 1 cut(s) 364
HpyCH4IV ACGT 1 cut(s) 204
HpyCH4V TGCA 4 cut(s) 9, 419, 479, 485
HpyF10VI GCNNNNNNNGC 1 cut(s) 69
HpyF3I CTNAG 3 cut(s) 221, 337, 431
HpySE526I ACGT 1 cut(s) 204
Hsp92II CATG 5 cut(s) 77, 196, 202, 329, 361
Kzo9I GATC 2 cut(s) 402, 436
LmnI GCTCC 1 cut(s) 278
LpnPI CCDG 3 cut(s) 13, 224, 453
MaeI CTAG 1 cut(s) 69
MaeII ACGT 1 cut(s) 204
MalI GATC 2 cut(s) 404, 438
MboI GATC 2 cut(s) 402, 436
MboII GAAGA 3 cut(s) 43, 407, 410
MlsI TGGCCA 1 cut(s) 197
MluCI AATT 1 cut(s) 464
MluNI TGGCCA 1 cut(s) 197
MnlI CCTC 4 cut(s) 68, 81, 227, 289
Mox20I TGGCCA 1 cut(s) 197
MroXI GAANNNNTTC 1 cut(s) 380
MscI TGGCCA 1 cut(s) 197
MslI CAYNNNNRTG 2 cut(s) 78, 197
Msp20I TGGCCA 1 cut(s) 197
MwoI GCNNNNNNNGC 1 cut(s) 69
NcoI CCATGG 1 cut(s) 198
NdeII GATC 2 cut(s) 402, 436
NheI GCTAGC 1 cut(s) 68
NlaIII CATG 5 cut(s) 77, 196, 202, 329, 361
NmeAIII GCCGAG 1 cut(s) 39
NspI RCATGY 1 cut(s) 329
PdmI GAANNNNTTC 1 cut(s) 380
PsiI TTATAA 1 cut(s) 303
PspPI GGNCC 1 cut(s) 354
RsaI GTAC 1 cut(s) 119
RsaNI GTAC 1 cut(s) 118
RseI CAYNNNNRTG 2 cut(s) 78, 197
Sau3AI GATC 2 cut(s) 402, 436
Sau96I GGNCC 1 cut(s) 354
SetI ASST 6 cut(s) 92, 207, 238, 275, 300, 310
SfcI CTRYAG 1 cut(s) 363
SmiMI CAYNNNNRTG 2 cut(s) 78, 197
Sse9I AATT 1 cut(s) 464
SspMI CTAG 1 cut(s) 69
StyI CCWWGG 1 cut(s) 198
TaaI ACNGT 1 cut(s) 364
TaiI ACGT 1 cut(s) 207
TaqI TCGA 3 cut(s) 95, 405, 458
TasI AATT 1 cut(s) 464
TatI WGTACW 1 cut(s) 117
TspDTI ATGAA 2 cut(s) 125, 477
TspGWI ACGGA 2 cut(s) 416, 486
XceI RCATGY 1 cut(s) 329
XmnI GAANNNNTTC 1 cut(s) 380
XspI CTAG 1 cut(s) 69
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.