MD07G1274100.v1.1

Belongs to the SKP1 family

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr07
Physical Location & Seq
Reverse (-)
33967974 .. 33970319
2346 bp
Loading structure...
UTR
Exon/CDS
Intron
MD07G1274100.v1.1.491

Sequence Viewer

Length: 210 bp
ATGTCAGAAGGTGTCATGGCGGTAGTCAAACCTGAGATGAAATCTTACATCTGGCTTCAAACTGCTGATGCCTCCATCCAACAAGTAGAAGAAGAGGTTGCCATGTTTTGTCCCATGATATGCCGAGAAATATTGCAAACAGGAATGGGATCTTCCAAAAACTATACTATATCACTTCCTCAACGAGTTAATCCTGCCATTTGGGCTTAA

Protein Analysis

70

Amino Acids

7.74

Weight (kDa)

4.82

Isoelectric Point (pI)

56.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 20
AclWI GGATC 1 cut(s) 157
AgsI TTSAA 1 cut(s) 59
AlwI GGATC 1 cut(s) 157
BccI CCATC 1 cut(s) 83
BglI GCCNNNNNGGC 1 cut(s) 203
BmsI GCATC 1 cut(s) 58
BseGI GGATG 1 cut(s) 75
BseMII CTCAG 1 cut(s) 24
BslFI GGGAC 1 cut(s) 96
BsmFI GGGAC 1 cut(s) 96
Bsp143I GATC 1 cut(s) 149
BspACI CCGC 1 cut(s) 20
BspCNI CTCAG 1 cut(s) 25
BspPI GGATC 1 cut(s) 157
BssMI GATC 1 cut(s) 149
Bst6I CTCTTC 1 cut(s) 87
BstDEI CTNAG 1 cut(s) 33
BstF5I GGATG 1 cut(s) 75
BstKTI GATC 1 cut(s) 152
BstMBI GATC 1 cut(s) 149
BstMWI GCNNNNNNNGC 1 cut(s) 203
BstX2I RGATCY 1 cut(s) 149
BstYI RGATCY 1 cut(s) 149
BtsCI GGATG 1 cut(s) 75
CviAII CATG 3 cut(s) 16, 103, 115
CviJI RGCY 2 cut(s) 55, 206
CviKI_1 RGCY 2 cut(s) 55, 206
DdeI CTNAG 1 cut(s) 33
DpnI GATC 1 cut(s) 151
DpnII GATC 1 cut(s) 149
Eam1104I CTCTTC 1 cut(s) 87
EarI CTCTTC 1 cut(s) 87
FaeI CATG 3 cut(s) 19, 106, 118
FaiI YATR 6 cut(s) 17, 104, 116, 121, 165, 170
FaqI GGGAC 1 cut(s) 96
FatI CATG 3 cut(s) 15, 102, 114
FokI GGATG 1 cut(s) 62
Hin1II CATG 3 cut(s) 19, 106, 118
Hpy188I TCNGA 1 cut(s) 7
HpyCH4V TGCA 1 cut(s) 136
HpyF10VI GCNNNNNNNGC 1 cut(s) 203
HpyF3I CTNAG 1 cut(s) 33
Hsp92II CATG 3 cut(s) 19, 106, 118
Kzo9I GATC 1 cut(s) 149
LpnPI CCDG 3 cut(s) 37, 45, 126
LweI GCATC 1 cut(s) 58
MalI GATC 1 cut(s) 151
MboI GATC 1 cut(s) 149
MboII GAAGA 3 cut(s) 101, 104, 144
MflI RGATCY 1 cut(s) 149
MmeI TCCRAC 1 cut(s) 103
MnlI CCTC 3 cut(s) 82, 88, 189
MseI TTAA 2 cut(s) 189, 208
MwoI GCNNNNNNNGC 1 cut(s) 203
NdeII GATC 1 cut(s) 149
NlaIII CATG 3 cut(s) 19, 106, 118
NmeAIII GCCGAG 1 cut(s) 149
PsuI RGATCY 1 cut(s) 149
SaqAI TTAA 2 cut(s) 189, 208
Sau3AI GATC 1 cut(s) 149
SetI ASST 3 cut(s) 13, 34, 99
SfaNI GCATC 1 cut(s) 58
SsiI CCGC 1 cut(s) 20
SspI AATATT 1 cut(s) 132
Tru1I TTAA 2 cut(s) 189, 208
Tru9I TTAA 2 cut(s) 189, 208
TspDTI ATGAA 1 cut(s) 53
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.