MD08G1068600.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr08
Physical Location & Seq
Reverse (-)
5464843 .. 5467583
2741 bp
Loading structure...
UTR
Exon/CDS
Intron
MD08G1068600.v1.1.491

Sequence Viewer

Length: 225 bp
ATGCTCTCGCTTCCTTCTCGATTACCTTCGTTGTGGTTGGAAAAGCTACAGACTGCAATGGTTGTGATTCTGGATGCTGACATGATTATCCACGGGCCGATTGCTCCTTGGGAACTTACTGCTGAGAAAGGCAAGCCTATTGCAGCGTATATAGGGAATATTACTACTACTATTTTTCTCTTTCATCAGACGAGCATTGTTTTGCAATCGCATTCTGTATTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families
No domains found.

Protein Analysis

75

Amino Acids

8.22

Weight (kDa)

6.23

Isoelectric Point (pI)

45.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AluBI AGCT 1 cut(s) 46
AluI AGCT 1 cut(s) 46
AoxI GGCC 1 cut(s) 95
ApeKI GCWGC 1 cut(s) 143
AspS9I GGNCC 1 cut(s) 95
BbvI GCAGC 1 cut(s) 155
BfmI CTRYAG 1 cut(s) 47
BisI GCNGC 1 cut(s) 144
BlsI GCNGC 1 cut(s) 145
BmgT120I GGNCC 1 cut(s) 95
BmsI GCATC 1 cut(s) 64
BsaJI CCNNGG 2 cut(s) 91, 107
Bse3DI GCAATG 1 cut(s) 63
BseDI CCNNGG 2 cut(s) 91, 107
BseGI GGATG 1 cut(s) 79
BseMI GCAATG 1 cut(s) 63
BseMII CTCAG 1 cut(s) 114
BseXI GCAGC 1 cut(s) 155
BshFI GGCC 1 cut(s) 97
BsmI GAATGC 1 cut(s) 211
BsnI GGCC 1 cut(s) 97
BspANI GGCC 1 cut(s) 97
BspCNI CTCAG 1 cut(s) 115
BsrDI GCAATG 1 cut(s) 63
BssECI CCNNGG 2 cut(s) 91, 107
BssT1I CCWWGG 1 cut(s) 107
BstC8I GCNNGC 1 cut(s) 134
BstDEI CTNAG 1 cut(s) 123
BstDSI CCRYGG 1 cut(s) 91
BstF5I GGATG 1 cut(s) 79
BstSFI CTRYAG 1 cut(s) 47
BstV1I GCAGC 1 cut(s) 155
BsuRI GGCC 1 cut(s) 97
BtgI CCRYGG 1 cut(s) 91
BtsCI GGATG 1 cut(s) 79
Cac8I GCNNGC 1 cut(s) 134
Cfr13I GGNCC 1 cut(s) 95
CviAII CATG 1 cut(s) 82
CviJI RGCY 3 cut(s) 46, 97, 136
CviKI_1 RGCY 3 cut(s) 46, 97, 136
DdeI CTNAG 1 cut(s) 123
Eco130I CCWWGG 1 cut(s) 107
EcoT14I CCWWGG 1 cut(s) 107
ErhI CCWWGG 1 cut(s) 107
FaeI CATG 1 cut(s) 85
FaiI YATR 3 cut(s) 83, 150, 152
FatI CATG 1 cut(s) 81
Fnu4HI GCNGC 1 cut(s) 144
FokI GGATG 1 cut(s) 86
Fsp4HI GCNGC 1 cut(s) 144
GluI GCNGC 1 cut(s) 144
HaeIII GGCC 1 cut(s) 97
Hin1II CATG 1 cut(s) 85
HinfI GANTC 1 cut(s) 67
Hpy188I TCNGA 1 cut(s) 189
Hpy188III TCNNGA 2 cut(s) 18, 71
HpyAV CCTTC 2 cut(s) 24, 36
HpyCH4V TGCA 3 cut(s) 56, 143, 205
HpyF3I CTNAG 1 cut(s) 123
Hsp92II CATG 1 cut(s) 85
LmnI GCTCC 1 cut(s) 109
LpnPI CCDG 1 cut(s) 56
Lsp1109I GCAGC 1 cut(s) 155
LweI GCATC 1 cut(s) 64
MmeI TCCRAC 1 cut(s) 18
Mva1269I GAATGC 1 cut(s) 211
NlaIII CATG 1 cut(s) 85
PctI GAATGC 1 cut(s) 211
PfeI GAWTC 1 cut(s) 67
PkrI GCNGC 1 cut(s) 145
PspPI GGNCC 1 cut(s) 95
SatI GCNGC 1 cut(s) 144
Sau96I GGNCC 1 cut(s) 95
SetI ASST 2 cut(s) 28, 48
SfaNI GCATC 1 cut(s) 64
SfcI CTRYAG 1 cut(s) 47
SgeI CNNG 9 cut(s) 19, 30, 83, 94, 104, 106, 120, 145, 204
SspI AATATT 1 cut(s) 160
StyI CCWWGG 1 cut(s) 107
TaqI TCGA 1 cut(s) 19
TfiI GAWTC 1 cut(s) 67
TseI GCWGC 1 cut(s) 143
TspDTI ATGAA 1 cut(s) 173
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.