MD08G1112000.v1.1

Polyketide cyclase / dehydrase and lipid transport

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr08
OG0006645
Physical Location & Seq
Forward (+)
9895598 .. 9896029
432 bp
Loading structure...
UTR
Exon/CDS
Intron
MD08G1112000.v1.1.491

Sequence Viewer

Length: 432 bp
ATGGAGCAACACTCAGATCCAAAGTGGGAAGCCAAGTTTTCTACAACCCTAAAAGATGCCACAGTGGACCAAATATGGCCTCTCTGCAAAGACTTCTTTTATTTCCACAAGTGGTTTCCAACCCTTGCCCCTTGCTATGGGATCCATGGAACCAACGGTGAACCCGGCTATATCAGACATTGCTCGCTGTTCTCAATCCCCTCCAAGAGTGGTGAGAAGTTCGTCAGCTGGTCCAAGGAACGATTAATAGCCATTGATGATCCTGACCATAGTCTGAGCTATAAGATCGTGGAGAGCAACATTGGGTTTAAGTCGTACGTCTCAACGTTCAGGATTGTTCCGCGTGGGGATATTGACGGTCGAGATGGGTGCGTGATCGAGTGGTCTAGAACCGTTGATCCTGTGAAGGGCGGATTCTTGGTGATTTGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Polyketide_cyc2

Protein Analysis

144

Amino Acids

16.41

Weight (kDa)

6.5

Isoelectric Point (pI)

19.01

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Polyketide_cyc2 PF10604 19 - 139 4.4e-15 Polyketide cyclase / dehydrase and lipid transport
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 343
AciI CCGC 2 cut(s) 341, 411
AclI AACGTT 1 cut(s) 326
AclWI GGATC 5 cut(s) 11, 136, 149, 254, 392
AfaI GTAC 1 cut(s) 317
AfiI CCNNNNNNNGG 2 cut(s) 137, 407
AloI GAACNNNNNNTCC 2 cut(s) 382, 414
AluBI AGCT 2 cut(s) 228, 279
AluI AGCT 2 cut(s) 228, 279
Alw26I GTCTC 1 cut(s) 325
AlwI GGATC 5 cut(s) 11, 136, 149, 254, 392
AoxI GGCC 1 cut(s) 77
AseI ATTAAT 1 cut(s) 245
AspS9I GGNCC 2 cut(s) 67, 231
AsuC2I CCSGG 1 cut(s) 165
AsuHPI GGTGA 2 cut(s) 170, 224
AvaII GGWCC 2 cut(s) 67, 231
BamHI GGATCC 1 cut(s) 141
BccI CCATC 1 cut(s) 359
BcgI CGANNNNNNTGC 2 cut(s) 351, 385
BcnI CCSGG 1 cut(s) 165
BcoDI GTCTC 1 cut(s) 325
BfaI CTAG 1 cut(s) 387
Bme1390I CCNGG 1 cut(s) 165
Bme18I GGWCC 2 cut(s) 67, 231
BmgT120I GGNCC 2 cut(s) 67, 231
BmiI GGNNCC 2 cut(s) 143, 151
BmrFI CCNGG 1 cut(s) 165
BmsI GCATC 1 cut(s) 46
BoxI GACNNNNGTC 1 cut(s) 270
BplI GAGNNNNNCTC 1 cut(s) 28
BpuMI CCSGG 1 cut(s) 165
BsaJI CCNNGG 2 cut(s) 145, 234
Bsc4I CCNNNNNNNGG 2 cut(s) 137, 407
Bse3DI GCAATG 1 cut(s) 178
BseDI CCNNGG 2 cut(s) 145, 234
BseLI CCNNNNNNNGG 2 cut(s) 137, 407
BseMI GCAATG 1 cut(s) 178
BseMII CTCAG 2 cut(s) 27, 266
Bsh1236I CGCG 1 cut(s) 343
Bsh1285I CGRYCG 1 cut(s) 361
BshFI GGCC 1 cut(s) 79
BsiEI CGRYCG 1 cut(s) 361
BsiSI CCGG 1 cut(s) 165
BsiWI CGTACG 1 cut(s) 315
BslI CCNNNNNNNGG 2 cut(s) 137, 407
BsmAI GTCTC 1 cut(s) 325
BsmBI CGTCTC 1 cut(s) 325
BsnI GGCC 1 cut(s) 79
Bsp143I GATC 6 cut(s) 16, 141, 259, 285, 375, 397
Bsp19I CCATGG 1 cut(s) 145
BspACI CCGC 2 cut(s) 341, 411
BspANI GGCC 1 cut(s) 79
BspCNI CTCAG 2 cut(s) 26, 267
BspFNI CGCG 1 cut(s) 343
BspLI GGNNCC 2 cut(s) 143, 151
BspPI GGATC 5 cut(s) 11, 136, 149, 254, 392
BsrDI GCAATG 1 cut(s) 178
BssECI CCNNGG 2 cut(s) 145, 234
BssMI GATC 6 cut(s) 16, 141, 259, 285, 375, 397
BssT1I CCWWGG 2 cut(s) 145, 234
Bst4CI ACNGT 4 cut(s) 64, 158, 359, 394
BstC8I GCNNGC 1 cut(s) 185
BstDEI CTNAG 2 cut(s) 13, 275
BstDSI CCRYGG 1 cut(s) 145
BstFNI CGCG 1 cut(s) 343
BstKTI GATC 6 cut(s) 19, 144, 262, 288, 378, 400
BstMAI GTCTC 1 cut(s) 325
BstMBI GATC 6 cut(s) 16, 141, 259, 285, 375, 397
BstMCI CGRYCG 1 cut(s) 361
BstPAI GACNNNNGTC 1 cut(s) 270
BstSCI CCNGG 1 cut(s) 163
BstUI CGCG 1 cut(s) 343
BstX2I RGATCY 2 cut(s) 16, 141
BstYI RGATCY 2 cut(s) 16, 141
BsuRI GGCC 1 cut(s) 79
BtgI CCRYGG 1 cut(s) 145
BtsIMutI CAGTG 1 cut(s) 69
Cac8I GCNNGC 1 cut(s) 185
Cfr13I GGNCC 2 cut(s) 67, 231
Csp6I GTAC 1 cut(s) 316
CviAII CATG 1 cut(s) 146
CviJI RGCY 6 cut(s) 32, 79, 168, 228, 251, 279
CviKI_1 RGCY 6 cut(s) 32, 79, 168, 228, 251, 279
CviQI GTAC 1 cut(s) 316
DdeI CTNAG 2 cut(s) 13, 275
DpnI GATC 6 cut(s) 18, 143, 261, 287, 377, 399
DpnII GATC 6 cut(s) 16, 141, 259, 285, 375, 397
EciI GGCGGA 1 cut(s) 426
Eco130I CCWWGG 2 cut(s) 145, 234
Eco47I GGWCC 2 cut(s) 67, 231
EcoT14I CCWWGG 2 cut(s) 145, 234
ErhI CCWWGG 2 cut(s) 145, 234
Esp3I CGTCTC 1 cut(s) 325
FaeI CATG 1 cut(s) 149
FaiI YATR 6 cut(s) 76, 138, 147, 171, 270, 282
FatI CATG 1 cut(s) 145
FspBI CTAG 1 cut(s) 387
HaeIII GGCC 1 cut(s) 79
HapII CCGG 1 cut(s) 165
Hin1II CATG 1 cut(s) 149
HinfI GANTC 1 cut(s) 414
HpaII CCGG 1 cut(s) 165
HphI GGTGA 2 cut(s) 170, 224
Hpy166II GTNNAC 2 cut(s) 67, 161
Hpy188I TCNGA 3 cut(s) 16, 176, 276
Hpy188III TCNNGA 4 cut(s) 263, 331, 362, 387
Hpy8I GTNNAC 2 cut(s) 67, 161
HpyAV CCTTC 1 cut(s) 400
HpyCH4III ACNGT 4 cut(s) 64, 158, 359, 394
HpyCH4IV ACGT 2 cut(s) 318, 326
HpyCH4V TGCA 1 cut(s) 87
HpyF3I CTNAG 2 cut(s) 13, 275
HpySE526I ACGT 2 cut(s) 318, 326
Hsp92II CATG 1 cut(s) 149
Kzo9I GATC 6 cut(s) 16, 141, 259, 285, 375, 397
LmnI GCTCC 1 cut(s) 4
LpnPI CCDG 5 cut(s) 178, 214, 276, 316, 414
LweI GCATC 1 cut(s) 46
MaeI CTAG 1 cut(s) 387
MaeII ACGT 2 cut(s) 318, 326
MalI GATC 6 cut(s) 18, 143, 261, 287, 377, 399
MboI GATC 6 cut(s) 16, 141, 259, 285, 375, 397
MflI RGATCY 2 cut(s) 16, 141
MmeI TCCRAC 1 cut(s) 143
MnlI CCTC 2 cut(s) 90, 211
MseI TTAA 2 cut(s) 245, 309
MspA1I CMGCKG 1 cut(s) 228
MspI CCGG 1 cut(s) 165
MspR9I CCNGG 1 cut(s) 165
MvnI CGCG 1 cut(s) 343
NciI CCSGG 1 cut(s) 165
NcoI CCATGG 1 cut(s) 145
NdeII GATC 6 cut(s) 16, 141, 259, 285, 375, 397
NlaIII CATG 1 cut(s) 149
NlaIV GGNNCC 2 cut(s) 143, 151
PfeI GAWTC 1 cut(s) 414
Pfl23II CGTACG 1 cut(s) 315
PshAI GACNNNNGTC 1 cut(s) 270
PshBI ATTAAT 1 cut(s) 245
Psp1406I AACGTT 1 cut(s) 326
PspLI CGTACG 1 cut(s) 315
PspN4I GGNNCC 2 cut(s) 143, 151
PspPI GGNCC 2 cut(s) 67, 231
PsuI RGATCY 2 cut(s) 16, 141
PvuII CAGCTG 1 cut(s) 228
RsaI GTAC 1 cut(s) 317
RsaNI GTAC 1 cut(s) 316
SaqAI TTAA 2 cut(s) 245, 309
Sau3AI GATC 6 cut(s) 16, 141, 259, 285, 375, 397
Sau96I GGNCC 2 cut(s) 67, 231
ScrFI CCNGG 1 cut(s) 165
SetI ASST 4 cut(s) 230, 281, 321, 329
SfaNI GCATC 1 cut(s) 46
SinI GGWCC 2 cut(s) 67, 231
SsiI CCGC 2 cut(s) 341, 411
SspMI CTAG 1 cut(s) 387
StyD4I CCNGG 1 cut(s) 163
StyI CCWWGG 2 cut(s) 145, 234
TaaI ACNGT 4 cut(s) 64, 158, 359, 394
TaiI ACGT 2 cut(s) 321, 329
TaqI TCGA 2 cut(s) 361, 378
TfiI GAWTC 1 cut(s) 414
Tru1I TTAA 2 cut(s) 245, 309
Tru9I TTAA 2 cut(s) 245, 309
TscAI CASTG 1 cut(s) 69
TspRI CASTG 1 cut(s) 69
VpaK11BI GGWCC 2 cut(s) 67, 231
VspI ATTAAT 1 cut(s) 245
XbaI TCTAGA 1 cut(s) 386
XspI CTAG 1 cut(s) 387
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.