MD12G1035500.v1.1

Iron-sulfur assembly protein IscA-like 1

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr12
Physical Location & Seq
Reverse (-)
3869724 .. 3872280
2557 bp
Loading structure...
UTR
Exon/CDS
Intron
MD12G1035500.v1.1.491

Sequence Viewer

Length: 408 bp
ATGGCTTCGCAAATTCTGGCGGCGGTAGCCGAGAGGGTCGGACCGGCGGCGAGGCGACAGGCCGTGAGCCTGACGGACGCGGCGGCGAATCGCATACGGCAGCTCCTAGAGCAGCGCCGGCGGCCTTATCTCAAGCTCGGAGTCAAGGCTCGCGGCTGCAACGGATTGTCCTACACTCTCAATTACGCAGATGATAAGGGGAAGTTCGACGAATTGGTGGAGGATAAAGGTGTGAAGATTTTGATTGATCCGAAGGCTCTGATGCACGTCATAGGAACGAAGATGGATTTTATAGATGATAAACTCAGGTCTGAGTTCGTATTCATCAATCCCAACTCTAAAGGACAGTGTGGCTGTGGGGAATCTTTCATGACAACAGGCGGCAGCGGAGCTACCAAGAAGGTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

136

Amino Acids

14.72

Weight (kDa)

9.51

Isoelectric Point (pI)

38.59

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Fe-S_biosyn PF01521 22 - 121 1.9e-18 Iron-sulphur cluster biosynthesis
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 2 cut(s) 80, 153
AciI CCGC 9 cut(s) 20, 23, 47, 80, 83, 121, 153, 381, 387
AclWI GGATC 1 cut(s) 242
AcsI RAATTY 1 cut(s) 12
AjiI CACGTC 1 cut(s) 268
AluBI AGCT 3 cut(s) 103, 136, 392
AluI AGCT 3 cut(s) 103, 136, 392
AlwI GGATC 1 cut(s) 242
AoxI GGCC 2 cut(s) 60, 122
ApeKI GCWGC 4 cut(s) 100, 112, 156, 384
ApoI RAATTY 1 cut(s) 12
AspLEI GCGC 1 cut(s) 117
AspS9I GGNCC 1 cut(s) 41
AvaII GGWCC 1 cut(s) 41
BbvI GCAGC 4 cut(s) 112, 124, 143, 396
BccI CCATC 1 cut(s) 277
BceAI ACGGC 2 cut(s) 47, 113
BfaI CTAG 1 cut(s) 107
BfoI RGCGCY 1 cut(s) 118
Bme18I GGWCC 1 cut(s) 41
BmgBI CACGTC 1 cut(s) 268
BmgT120I GGNCC 1 cut(s) 41
BmsI GCATC 1 cut(s) 252
BpuEI CTTGAG 1 cut(s) 116
BsaXI ACNNNNNCTCC 2 cut(s) 87, 117
Bse118I RCCGGY 2 cut(s) 43, 117
BseMII CTCAG 2 cut(s) 303, 319
BseXI GCAGC 4 cut(s) 112, 124, 143, 396
Bsh1236I CGCG 2 cut(s) 80, 153
BshFI GGCC 2 cut(s) 62, 124
BsiSI CCGG 2 cut(s) 44, 118
BsnI GGCC 2 cut(s) 62, 124
Bsp143I GATC 1 cut(s) 247
BspACI CCGC 9 cut(s) 20, 23, 47, 80, 83, 121, 153, 381, 387
BspANI GGCC 2 cut(s) 62, 124
BspCNI CTCAG 2 cut(s) 304, 318
BspFNI CGCG 2 cut(s) 80, 153
BspHI TCATGA 1 cut(s) 369
BspPI GGATC 1 cut(s) 242
BsrFI RCCGGY 2 cut(s) 43, 117
BssAI RCCGGY 2 cut(s) 43, 117
BssMI GATC 1 cut(s) 247
Bst4CI ACNGT 1 cut(s) 348
BstC8I GCNNGC 2 cut(s) 119, 151
BstDEI CTNAG 2 cut(s) 305, 312
BstFNI CGCG 2 cut(s) 80, 153
BstH2I RGCGCY 1 cut(s) 118
BstHHI GCGC 1 cut(s) 117
BstKTI GATC 1 cut(s) 250
BstMBI GATC 1 cut(s) 247
BstMWI GCNNNNNNNGC 4 cut(s) 26, 109, 118, 121
BstUI CGCG 2 cut(s) 80, 153
BstV1I GCAGC 4 cut(s) 112, 124, 143, 396
BsuRI GGCC 2 cut(s) 62, 124
BtrI CACGTC 1 cut(s) 268
BtsIMutI CAGTG 1 cut(s) 353
Cac8I GCNNGC 2 cut(s) 119, 151
CciI TCATGA 1 cut(s) 369
CfoI GCGC 1 cut(s) 117
Cfr10I RCCGGY 2 cut(s) 43, 117
Cfr13I GGNCC 1 cut(s) 41
CpoI CGGWCCG 1 cut(s) 41
CseI GACGC 1 cut(s) 86
CspI CGGWCCG 1 cut(s) 41
CviAII CATG 1 cut(s) 370
DdeI CTNAG 2 cut(s) 305, 312
DpnI GATC 1 cut(s) 249
DpnII GATC 1 cut(s) 247
Eco47I GGWCC 1 cut(s) 41
FaeI CATG 1 cut(s) 373
FaiI YATR 5 cut(s) 95, 272, 293, 371, 406
FatI CATG 1 cut(s) 369
FspBI CTAG 1 cut(s) 107
GlaI GCGC 1 cut(s) 116
HaeII RGCGCY 1 cut(s) 118
HaeIII GGCC 2 cut(s) 62, 124
HapII CCGG 2 cut(s) 44, 118
HgaI GACGC 1 cut(s) 86
HhaI GCGC 1 cut(s) 117
Hin1II CATG 1 cut(s) 373
Hin6I GCGC 1 cut(s) 115
HinP1I GCGC 1 cut(s) 115
HinfI GANTC 3 cut(s) 88, 141, 362
HpaII CCGG 2 cut(s) 44, 118
Hpy188I TCNGA 5 cut(s) 41, 140, 252, 261, 313
Hpy188III TCNNGA 1 cut(s) 370
Hpy99I CGWCG 1 cut(s) 212
HpyAV CCTTC 2 cut(s) 247, 394
HpyCH4III ACNGT 1 cut(s) 348
HpyCH4IV ACGT 1 cut(s) 267
HpyCH4V TGCA 2 cut(s) 159, 265
HpyF10VI GCNNNNNNNGC 4 cut(s) 26, 109, 118, 121
HpyF3I CTNAG 2 cut(s) 305, 312
HpySE526I ACGT 1 cut(s) 267
Hsp92II CATG 1 cut(s) 373
HspAI GCGC 1 cut(s) 115
KroI GCCGGC 1 cut(s) 117
KroNI GCCGGC 1 cut(s) 119
Kzo9I GATC 1 cut(s) 247
LmnI GCTCC 2 cut(s) 108, 389
LpnPI CCDG 7 cut(s) 2, 44, 57, 83, 131, 292, 363
Lsp1109I GCAGC 4 cut(s) 112, 124, 143, 396
LweI GCATC 1 cut(s) 252
MaeI CTAG 1 cut(s) 107
MaeII ACGT 1 cut(s) 267
MalI GATC 1 cut(s) 249
MboI GATC 1 cut(s) 247
MboII GAAGA 2 cut(s) 247, 292
MluCI AATT 3 cut(s) 12, 181, 212
MlyI GAGTC 1 cut(s) 150
MmeI TCCRAC 1 cut(s) 19
MnlI CCTC 3 cut(s) 27, 45, 214
MreI CGCCGGCG 1 cut(s) 117
MroNI GCCGGC 1 cut(s) 117
MspA1I CMGCKG 1 cut(s) 387
MspI CCGG 2 cut(s) 44, 118
MvnI CGCG 2 cut(s) 80, 153
MwoI GCNNNNNNNGC 4 cut(s) 26, 109, 118, 121
NaeI GCCGGC 1 cut(s) 119
NdeII GATC 1 cut(s) 247
NgoMIV GCCGGC 1 cut(s) 117
NlaIII CATG 1 cut(s) 373
NmeAIII GCCGAG 1 cut(s) 55
PagI TCATGA 1 cut(s) 369
PdiI GCCGGC 1 cut(s) 119
PfeI GAWTC 2 cut(s) 88, 362
PleI GAGTC 1 cut(s) 149
PpsI GAGTC 1 cut(s) 149
PspPI GGNCC 1 cut(s) 41
Rsr2I CGGWCCG 1 cut(s) 41
RsrII CGGWCCG 1 cut(s) 41
Sau3AI GATC 1 cut(s) 247
Sau96I GGNCC 1 cut(s) 41
SchI GAGTC 1 cut(s) 150
SetI ASST 7 cut(s) 105, 138, 232, 270, 311, 394, 405
SfaNI GCATC 1 cut(s) 252
SgrAI CRCCGGYG 1 cut(s) 117
SinI GGWCC 1 cut(s) 41
SmlI CTYRAG 1 cut(s) 131
SmoI CTYRAG 1 cut(s) 131
Sse9I AATT 3 cut(s) 12, 181, 212
SsiI CCGC 9 cut(s) 20, 23, 47, 80, 83, 121, 153, 381, 387
SspMI CTAG 1 cut(s) 107
TaaI ACNGT 1 cut(s) 348
TaiI ACGT 1 cut(s) 270
TaqI TCGA 1 cut(s) 207
TasI AATT 3 cut(s) 12, 181, 212
TauI GCSGC 7 cut(s) 23, 50, 83, 86, 124, 156, 384
TfiI GAWTC 2 cut(s) 88, 362
TscAI CASTG 1 cut(s) 353
TseI GCWGC 4 cut(s) 100, 112, 156, 384
TspDTI ATGAA 2 cut(s) 313, 358
TspGWI ACGGA 2 cut(s) 89, 177
TspRI CASTG 1 cut(s) 353
VpaK11BI GGWCC 1 cut(s) 41
XapI RAATTY 1 cut(s) 12
XspI CTAG 1 cut(s) 107
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.