Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0040292.1

Orthogroup ID

OG0004631

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 531

Gene Structure 531 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0040292.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 308 bp

atggcttcgcagattctggctgcggcggcggggaggacggcagcggcggcgaggcggcaagcggtgagcttgacggatgcggcggcttctagaatacggcagctgctagagcagcgccagcggtcgtatctgaagctcggggttaaggcgcgtggctgcaacggcttgtcatacactctcaattacgcagatgataagggaaagttcgatgagttggttgaagataaaggcgtgaagatattgatcgatccaaaggctctgatgcatgttattggaaccaagatggattttgtggatgacaaactcag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Fe-S_biosyn

Protein Analysis

102

Amino Acids

11.12

Weight (kDa)

9.56

Isoelectric Point (pI)

34.47

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004631)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G16710 AT2G16710 AT2G16710
fragaria_vesca	FvH4_6g18590
malus_domestica	MD12G1035500.v1.1 MD14G1022300.v1.1
prunus_persica	Prupe.7G111000_v2.0.a1
pyrus_communis	pycom12g02330 pycom14g02130
rosa_chinensis	RchiOBHm_Chr3g0473171 RchiOBHm_Chr6g0270521
rosa_laevigata	RLG00000024023
rosa_multiflora	Rmu_sc0004171.1_g000005 Rmu_sc0004477.1_g000002 Rmu_sc0039741.1_g000002 Rmu_sc0040292.1_g000001
rosa_roxburghii	Rroxscaffold_6G00408250 Rroxscaffold_7G00197770 Rroxscaffold_7G00197850
rosa_rugosa	Rorug03G0132000 Rorug06G0055200
rosa_samantha	Rh3BG210000 Rh3CG207100 Rh3DG207200 Rh6AG174400 Rh6CG173600
rosa_wichuraiana	Rw0G008110 Rw0G019030 Rw6G014830 Rw6G014860 Rw7G028370

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	1 cut(s)	151
AclWI	GGATC	1 cut(s)	242
AcuI	CTGAAG	1 cut(s)	152
AgsI	TTSAA	1 cut(s)	221
AluBI	AGCT	3 cut(s)	69, 103, 136
AluI	AGCT	3 cut(s)	69, 103, 136
AlwI	GGATC	1 cut(s)	242
AlwNI	CAGNNNCTG	1 cut(s)	16
Ama87I	CYCGRG	1 cut(s)	137
ApeKI	GCWGC	6 cut(s)	20, 41, 100, 103, 112, 156
AspLEI	GCGC	2 cut(s)	117, 151
AsuHPI	GGTGA	1 cut(s)	76
AvaI	CYCGRG	1 cut(s)	137
BbvI	GCAGC	6 cut(s)	7, 53, 90, 112, 124, 143
BccI	CCATC	1 cut(s)	277
BceAI	ACGGC	3 cut(s)	54, 113, 178
BfaI	CTAG	2 cut(s)	90, 107
BfoI	RGCGCY	1 cut(s)	118
BmeT110I	CYCGRG	1 cut(s)	137
BmiI	GGNNCC	1 cut(s)	277
BmsI	GCATC	2 cut(s)	67, 252
Bsa29I	ATCGAT	1 cut(s)	246
BsaBI	GATNNNNATC	1 cut(s)	242
Bse8I	GATNNNNATC	1 cut(s)	242
BseCI	ATCGAT	1 cut(s)	246
BseGI	GGATG	2 cut(s)	82, 301
BseJI	GATNNNNATC	1 cut(s)	242
BseXI	GCAGC	6 cut(s)	7, 53, 90, 112, 124, 143
Bsh1236I	CGCG	1 cut(s)	151
Bsh1285I	CGRYCG	1 cut(s)	125
BshVI	ATCGAT	1 cut(s)	246
BsiEI	CGRYCG	1 cut(s)	125
BsiHKCI	CYCGRG	1 cut(s)	137
BsoBI	CYCGRG	1 cut(s)	137
Bsp143I	GATC	2 cut(s)	243, 247
BspDI	ATCGAT	1 cut(s)	246
BspFNI	CGCG	1 cut(s)	151
BspLI	GGNNCC	1 cut(s)	277
BspPI	GGATC	1 cut(s)	242
BssMI	GATC	2 cut(s)	243, 247
BstC8I	GCNNGC	2 cut(s)	60, 119
BstDEI	CTNAG	1 cut(s)	305
BstF5I	GGATG	2 cut(s)	82, 301
BstFNI	CGCG	1 cut(s)	151
BstH2I	RGCGCY	1 cut(s)	118
BstHHI	GCGC	2 cut(s)	117, 151
BstKTI	GATC	2 cut(s)	246, 250
BstMBI	GATC	2 cut(s)	243, 247
BstMCI	CGRYCG	1 cut(s)	125
BstMWI	GCNNNNNNNGC	6 cut(s)	26, 47, 109, 112, 118, 162
BstNSI	RCATGY	1 cut(s)	269
BstUI	CGCG	1 cut(s)	151
BstV1I	GCAGC	6 cut(s)	7, 53, 90, 112, 124, 143
Bsu15I	ATCGAT	1 cut(s)	246
BsuTUI	ATCGAT	1 cut(s)	246
BtsCI	GGATG	2 cut(s)	82, 301
Cac8I	GCNNGC	2 cut(s)	60, 119
CaiI	CAGNNNCTG	1 cut(s)	16
CfoI	GCGC	2 cut(s)	117, 151
ClaI	ATCGAT	1 cut(s)	246
CviAII	CATG	1 cut(s)	266
CviJI	RGCY	9 cut(s)	5, 20, 69, 86, 103, 136, 156, 165, 257
CviKI_1	RGCY	9 cut(s)	5, 20, 69, 86, 103, 136, 156, 165, 257
DdeI	CTNAG	1 cut(s)	305
DpnI	GATC	2 cut(s)	245, 249
DpnII	GATC	2 cut(s)	243, 247
Eco57I	CTGAAG	1 cut(s)	152
Eco88I	CYCGRG	1 cut(s)	137
EcoT22I	ATGCAT	1 cut(s)	267
FaeI	CATG	1 cut(s)	269
FaiI	YATR	2 cut(s)	172, 267
FatI	CATG	1 cut(s)	265
FauI	CCCGC	1 cut(s)	22
FokI	GGATG	1 cut(s)	89
FspBI	CTAG	2 cut(s)	90, 107
GlaI	GCGC	2 cut(s)	116, 150
HaeII	RGCGCY	1 cut(s)	118
HhaI	GCGC	2 cut(s)	117, 151
Hin1II	CATG	1 cut(s)	269
Hin6I	GCGC	2 cut(s)	115, 149
HinP1I	GCGC	2 cut(s)	115, 149
HinfI	GANTC	1 cut(s)	13
HphI	GGTGA	1 cut(s)	76
Hpy188I	TCNGA	2 cut(s)	132, 261
Hpy188III	TCNNGA	1 cut(s)	90
HpyCH4V	TGCA	2 cut(s)	159, 265
HpyF10VI	GCNNNNNNNGC	6 cut(s)	26, 47, 109, 112, 118, 162
HpyF3I	CTNAG	1 cut(s)	305
Hsp92II	CATG	1 cut(s)	269
HspAI	GCGC	2 cut(s)	115, 149
Kzo9I	GATC	2 cut(s)	243, 247
LpnPI	CCDG	2 cut(s)	2, 131
Lsp1109I	GCAGC	6 cut(s)	7, 53, 90, 112, 124, 143
LweI	GCATC	2 cut(s)	67, 252
MaeI	CTAG	2 cut(s)	90, 107
MalI	GATC	2 cut(s)	245, 249
MboI	GATC	2 cut(s)	243, 247
MboII	GAAGA	2 cut(s)	233, 247
MluCI	AATT	1 cut(s)	181
MnlI	CCTC	2 cut(s)	27, 45
Mph1103I	ATGCAT	1 cut(s)	267
MseI	TTAA	1 cut(s)	144
MspA1I	CMGCKG	3 cut(s)	44, 103, 121
MvnI	CGCG	1 cut(s)	151
MwoI	GCNNNNNNNGC	6 cut(s)	26, 47, 109, 112, 118, 162
NdeII	GATC	2 cut(s)	243, 247
NlaIII	CATG	1 cut(s)	269
NlaIV	GGNNCC	1 cut(s)	277
NsiI	ATGCAT	1 cut(s)	267
NspI	RCATGY	1 cut(s)	269
PfeI	GAWTC	1 cut(s)	13
PspN4I	GGNNCC	1 cut(s)	277
PstNI	CAGNNNCTG	1 cut(s)	16
PvuII	CAGCTG	1 cut(s)	103
SaqAI	TTAA	1 cut(s)	144
Sau3AI	GATC	2 cut(s)	243, 247
SetI	ASST	3 cut(s)	71, 105, 138
SfaNI	GCATC	2 cut(s)	67, 252
Sse9I	AATT	1 cut(s)	181
SspMI	CTAG	2 cut(s)	90, 107
TaqI	TCGA	2 cut(s)	207, 246
TasI	AATT	1 cut(s)	181
TauI	GCSGC	7 cut(s)	26, 29, 47, 50, 58, 83, 86
TfiI	GAWTC	1 cut(s)	13
Tru1I	TTAA	1 cut(s)	144
Tru9I	TTAA	1 cut(s)	144
TseI	GCWGC	6 cut(s)	20, 41, 100, 103, 112, 156
TspGWI	ACGGA	1 cut(s)	89
XbaI	TCTAGA	1 cut(s)	89
XceI	RCATGY	1 cut(s)	269
XspI	CTAG	2 cut(s)	90, 107
Zsp2I	ATGCAT	1 cut(s)	267

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.