MD14G1052200.v1.1

Dirigent proteins impart stereoselectivity on the phenoxy radical-coupling reaction, yielding optically active lignans from two molecules of coniferyl alcohol in the biosynthesis of lignans, flavonolignans, and alkaloids and thus plays a central role in plant secondary metabolism

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr14
OG0003503
Physical Location & Seq
Forward (+)
5031736 .. 5032326
591 bp
Loading structure...
UTR
Exon/CDS
Intron
MD14G1052200.v1.1.491

Sequence Viewer

Length: 591 bp
ATGGCCAAGACCCTCCAAAACCTTAGTTCTACCTACACCATTCTCATAACCATTTCCTTCTTCTTCCTCTCAACCCTTGTTGCTTCAGAGACTCACCGTTTCTCAAGGCCGTTATCTTCATCAAAACATGGTCTAAAGAAAGAGAAACTAAGCCATCTTCACTTCTACTTTCATGACATAGTGAGTGGCCGAACCCCCACGGCTGTTAAAGTGGCTGAGGCACCCATTACAAACACTTCCATGACTGGCTTTGGCACCGTGGTCATGATGGACGATCCATTGACTATTGGCCCTGAATCGAACTCTAAGCTAGTTGGAAAAGCCCAAGGTATTTATGCTGTAGCTTCACAAAGTGAGGTGGGGTTTTTGATGGCCTTGAATTTTGTTTTTGTTGAAGGGAAGTATAATGGTAGCACTCTTAGTGTGTTGGGGCGCAATGCCGTGTTGTCAGCCGTTAGGGAGATGCCGATAGTAGGCGGAAGTGGCCTTTTCCGATTTGCTCGTGGCTATGCTCATGCTAGCACTCACCAGTTTGACATCAAAACTGGAGATGCTGTTGTGGAATATAATGTTTATGTCTTCCATTATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Dirigent

Protein Analysis

197

Amino Acids

21.4

Weight (kDa)

9.3

Isoelectric Point (pI)

23.6

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Dirigent PF03018 51 - 194 2e-60 Dirigent-like protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 220, 254
AciI CCGC 1 cut(s) 477
AclWI GGATC 1 cut(s) 269
AcoI YGGCCR 2 cut(s) 3, 187
AcsI RAATTY 1 cut(s) 379
AcuI CTGAAG 1 cut(s) 69
AdeI CACNNNGTG 1 cut(s) 353
AfiI CCNNNNNNNGG 1 cut(s) 473
AgsI TTSAA 2 cut(s) 379, 395
AluBI AGCT 2 cut(s) 310, 344
AluI AGCT 2 cut(s) 310, 344
Alw26I GTCTC 1 cut(s) 83
AlwI GGATC 1 cut(s) 269
AoxI GGCC 6 cut(s) 3, 107, 187, 289, 372, 484
ApoI RAATTY 1 cut(s) 379
AspLEI GCGC 1 cut(s) 435
AspS9I GGNCC 1 cut(s) 290
AsuHPI GGTGA 2 cut(s) 86, 518
AsuNHI GCTAGC 1 cut(s) 518
BalI TGGCCA 1 cut(s) 5
BanI GGYRCC 2 cut(s) 220, 254
BauI CACGAG 1 cut(s) 501
BbsI GAAGAC 1 cut(s) 571
BbvCI CCTCAGC 1 cut(s) 216
BccI CCATC 3 cut(s) 162, 262, 364
BceAI ACGGC 4 cut(s) 94, 216, 425, 437
BcoDI GTCTC 1 cut(s) 83
BfaI CTAG 2 cut(s) 311, 519
BfmI CTRYAG 1 cut(s) 339
BmgT120I GGNCC 1 cut(s) 290
BmiI GGNNCC 2 cut(s) 222, 256
BmsI GCATC 2 cut(s) 453, 541
BmtI GCTAGC 1 cut(s) 522
BpiI GAAGAC 1 cut(s) 571
BpmI CTGGAG 1 cut(s) 567
Bpu10I CCTNAGC 1 cut(s) 216
BpuEI CTTGAG 1 cut(s) 88
BsaJI CCNNGG 3 cut(s) 198, 258, 325
BsaXI ACNNNNNCTCC 2 cut(s) 540, 570
Bsc4I CCNNNNNNNGG 1 cut(s) 473
Bse1I ACTGG 3 cut(s) 250, 529, 550
Bse3DI GCAATG 1 cut(s) 442
BseDI CCNNGG 3 cut(s) 198, 258, 325
BseLI CCNNNNNNNGG 1 cut(s) 473
BseMI GCAATG 1 cut(s) 442
BseMII CTCAG 1 cut(s) 207
BseNI ACTGG 3 cut(s) 250, 529, 550
BshFI GGCC 6 cut(s) 5, 109, 189, 291, 374, 486
BshNI GGYRCC 2 cut(s) 220, 254
BslI CCNNNNNNNGG 1 cut(s) 473
BsmAI GTCTC 1 cut(s) 83
BsnI GGCC 6 cut(s) 5, 109, 189, 291, 374, 486
Bsp143I GATC 1 cut(s) 274
BspACI CCGC 1 cut(s) 477
BspANI GGCC 6 cut(s) 5, 109, 189, 291, 374, 486
BspCNI CTCAG 1 cut(s) 208
BspHI TCATGA 2 cut(s) 172, 264
BspLI GGNNCC 2 cut(s) 222, 256
BspOI GCTAGC 1 cut(s) 522
BspPI GGATC 1 cut(s) 269
BspT107I GGYRCC 2 cut(s) 220, 254
BsrDI GCAATG 1 cut(s) 442
BsrI ACTGG 3 cut(s) 250, 529, 550
BssECI CCNNGG 3 cut(s) 198, 258, 325
BssMI GATC 1 cut(s) 274
BssSI CACGAG 1 cut(s) 501
BssT1I CCWWGG 1 cut(s) 325
Bst2BI CACGAG 1 cut(s) 501
Bst4CI ACNGT 2 cut(s) 98, 259
BstC8I GCNNGC 1 cut(s) 520
BstDEI CTNAG 5 cut(s) 23, 149, 216, 306, 419
BstDSI CCRYGG 2 cut(s) 198, 258
BstHHI GCGC 1 cut(s) 435
BstKTI GATC 1 cut(s) 277
BstMAI GTCTC 1 cut(s) 83
BstMBI GATC 1 cut(s) 274
BstMWI GCNNNNNNNGC 1 cut(s) 483
BstSFI CTRYAG 1 cut(s) 339
BstV2I GAAGAC 1 cut(s) 571
BsuRI GGCC 6 cut(s) 5, 109, 189, 291, 374, 486
BtgI CCRYGG 2 cut(s) 198, 258
Cac8I GCNNGC 1 cut(s) 520
CciI TCATGA 2 cut(s) 172, 264
CfoI GCGC 1 cut(s) 435
Cfr13I GGNCC 1 cut(s) 290
CviAII CATG 5 cut(s) 128, 173, 241, 265, 515
DdeI CTNAG 5 cut(s) 23, 149, 216, 306, 419
DpnI GATC 1 cut(s) 276
DpnII GATC 1 cut(s) 274
DraIII CACNNNGTG 1 cut(s) 353
EaeI YGGCCR 2 cut(s) 3, 187
EciI GGCGGA 1 cut(s) 492
Eco130I CCWWGG 1 cut(s) 325
Eco57I CTGAAG 1 cut(s) 69
EcoT14I CCWWGG 1 cut(s) 325
ErhI CCWWGG 1 cut(s) 325
FaeI CATG 5 cut(s) 131, 176, 244, 268, 518
FatI CATG 5 cut(s) 127, 172, 240, 264, 514
FspBI CTAG 2 cut(s) 311, 519
GlaI GCGC 1 cut(s) 434
GsuI CTGGAG 1 cut(s) 567
HaeIII GGCC 6 cut(s) 5, 109, 189, 291, 374, 486
HhaI GCGC 1 cut(s) 435
Hin1II CATG 5 cut(s) 131, 176, 244, 268, 518
Hin6I GCGC 1 cut(s) 433
HinP1I GCGC 1 cut(s) 433
HinfI GANTC 2 cut(s) 91, 296
HphI GGTGA 2 cut(s) 86, 518
Hpy188I TCNGA 2 cut(s) 88, 494
Hpy188III TCNNGA 2 cut(s) 173, 265
HpyAV CCTTC 2 cut(s) 67, 389
HpyCH4III ACNGT 2 cut(s) 98, 259
HpyF10VI GCNNNNNNNGC 1 cut(s) 483
HpyF3I CTNAG 5 cut(s) 23, 149, 216, 306, 419
Hsp92II CATG 5 cut(s) 131, 176, 244, 268, 518
HspAI GCGC 1 cut(s) 433
Kzo9I GATC 1 cut(s) 274
LpnPI CCDG 4 cut(s) 231, 306, 531, 542
LweI GCATC 2 cut(s) 453, 541
MaeI CTAG 2 cut(s) 311, 519
MalI GATC 1 cut(s) 276
MboI GATC 1 cut(s) 274
MboII GAAGA 5 cut(s) 52, 55, 108, 149, 571
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 1 cut(s) 379
MluNI TGGCCA 1 cut(s) 5
MlyI GAGTC 1 cut(s) 85
MmeI TCCRAC 1 cut(s) 295
MnlI CCTC 4 cut(s) 23, 77, 211, 349
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
MseI TTAA 2 cut(s) 207, 589
MslI CAYNNNNRTG 1 cut(s) 239
Msp20I TGGCCA 1 cut(s) 5
MwoI GCNNNNNNNGC 1 cut(s) 483
NdeII GATC 1 cut(s) 274
NheI GCTAGC 1 cut(s) 518
NlaIII CATG 5 cut(s) 131, 176, 244, 268, 518
NlaIV GGNNCC 2 cut(s) 222, 256
PagI TCATGA 2 cut(s) 172, 264
PfeI GAWTC 1 cut(s) 296
PleI GAGTC 1 cut(s) 85
PpsI GAGTC 1 cut(s) 85
PspN4I GGNNCC 2 cut(s) 222, 256
PspPI GGNCC 1 cut(s) 290
RseI CAYNNNNRTG 1 cut(s) 239
SaqAI TTAA 2 cut(s) 207, 589
Sau3AI GATC 1 cut(s) 274
Sau96I GGNCC 1 cut(s) 290
SchI GAGTC 1 cut(s) 85
SetI ASST 6 cut(s) 24, 35, 312, 331, 346, 360
SfaNI GCATC 2 cut(s) 453, 541
SfcI CTRYAG 1 cut(s) 339
SmiMI CAYNNNNRTG 1 cut(s) 239
SmlI CTYRAG 1 cut(s) 103
SmoI CTYRAG 1 cut(s) 103
Sse9I AATT 1 cut(s) 379
SsiI CCGC 1 cut(s) 477
SspMI CTAG 2 cut(s) 311, 519
StyI CCWWGG 1 cut(s) 325
TaaI ACNGT 2 cut(s) 98, 259
TaqI TCGA 1 cut(s) 299
TasI AATT 1 cut(s) 379
TfiI GAWTC 1 cut(s) 296
Tru1I TTAA 2 cut(s) 207, 589
Tru9I TTAA 2 cut(s) 207, 589
TspDTI ATGAA 2 cut(s) 108, 161
XapI RAATTY 1 cut(s) 379
XspI CTAG 2 cut(s) 311, 519
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.