pycom14g04350

Dirigent proteins impart stereoselectivity on the phenoxy radical-coupling reaction, yielding optically active lignans from two molecules of coniferyl alcohol in the biosynthesis of lignans, flavonolignans, and alkaloids and thus plays a central role in plant secondary metabolism

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr14
OG0003503
Physical Location & Seq
Forward (+)
3799607 .. 3800733
1127 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom14g04350.1

Sequence Viewer

Length: 690 bp
ATGCTAGTACAGAGTTCCCACAAAACAAAACTACTAGTCTTAAAACCCTTTTATACTTCTCTCCTTCAAAAAGCTCTATACCATCCTCTATTCTCTAAAATGGCCAAGACCCTCCAAACCCTCGGTTCTAACTACACCATTCTCATAGCCATTTCCTTCTTCTTCCTCTCAACCCTTGTCACTTCAGAGACTAACCGTTTCTCAAGACCGTTATCTCTATCAAAACATGGTCTAAAGAAAGAGAAGCTAAGCCATCTTCACTTCTACTTTCATGACATAGTGAGTGGCCGAACCCCCACGGCAGTTAAAGTGGCTGAGGCACCGACTACAAACACTTCCATGACTGGCTTTGGCACCGTGGTCATGATGGACGATCCATTGACCATTGGCCCTAAATCGAGCTCTAAGCTAGTCGGAAAAGCCCAAGGTATTTATGCTGTAGCTTCACAAAGTGAGGTGGGGTTTTTGATGGCCTTGAATTTTGTTTTTGTTGAAGGGAAATATAATGGTAGCACTCTCAGTGTGTTGGGGCGCAATGCGGTGTTCTCAGCCGTGAGGGAGATGCCGATAGTAGGTGGAAGCGGGCTTTTCCGATTTGCTCGGGGCTATGCTCATGCTAGCACTCACCAGTTTAACATCAAAACTGGAGATGCTGTTGTGGAATATAATGTTTATGTCTTCCATTATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Dirigent

Protein Analysis

230

Amino Acids

25.2

Weight (kDa)

9.86

Isoelectric Point (pI)

27.43

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Dirigent PF03018 84 - 227 2.7e-60 Dirigent-like protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 319, 353
AciI CCGC 2 cut(s) 539, 582
AclWI GGATC 1 cut(s) 368
AcoI YGGCCR 2 cut(s) 102, 286
AcsI RAATTY 1 cut(s) 478
AcuI CTGAAG 1 cut(s) 168
AdeI CACNNNGTG 1 cut(s) 452
AfaI GTAC 1 cut(s) 9
AfiI CCNNNNNNNGG 1 cut(s) 572
AgsI TTSAA 3 cut(s) 68, 478, 494
AhlI ACTAGT 1 cut(s) 34
AluBI AGCT 5 cut(s) 74, 247, 402, 409, 443
AluI AGCT 5 cut(s) 74, 247, 402, 409, 443
Alw21I GWGCWC 1 cut(s) 404
Alw26I GTCTC 1 cut(s) 182
AlwI GGATC 1 cut(s) 368
Ama87I CYCGRG 1 cut(s) 600
AoxI GGCC 4 cut(s) 102, 286, 388, 471
ApoI RAATTY 1 cut(s) 478
AspLEI GCGC 1 cut(s) 534
AspS9I GGNCC 1 cut(s) 389
AsuHPI GGTGA 1 cut(s) 617
AsuNHI GCTAGC 1 cut(s) 617
AvaI CYCGRG 1 cut(s) 600
BalI TGGCCA 1 cut(s) 104
BanI GGYRCC 2 cut(s) 319, 353
BanII GRGCYC 1 cut(s) 404
BbsI GAAGAC 1 cut(s) 670
Bbv12I GWGCWC 1 cut(s) 404
BbvCI CCTCAGC 1 cut(s) 315
BccI CCATC 4 cut(s) 90, 261, 361, 463
BceAI ACGGC 2 cut(s) 315, 536
BcoDI GTCTC 1 cut(s) 182
BcuI ACTAGT 1 cut(s) 34
BfaI CTAG 4 cut(s) 5, 35, 410, 618
BfmI CTRYAG 1 cut(s) 438
BlpI GCTNAGC 1 cut(s) 248
BmeT110I CYCGRG 1 cut(s) 600
BmgT120I GGNCC 1 cut(s) 389
BmiI GGNNCC 2 cut(s) 321, 355
BmsI GCATC 2 cut(s) 552, 640
BmtI GCTAGC 1 cut(s) 621
BpiI GAAGAC 1 cut(s) 670
BpmI CTGGAG 1 cut(s) 666
Bpu10I CCTNAGC 1 cut(s) 315
Bpu1102I GCTNAGC 1 cut(s) 248
BpuEI CTTGAG 1 cut(s) 187
BsaJI CCNNGG 4 cut(s) 121, 297, 357, 424
BsaXI ACNNNNNCTCC 2 cut(s) 639, 669
Bsc4I CCNNNNNNNGG 1 cut(s) 572
Bse1I ACTGG 3 cut(s) 349, 628, 649
Bse3DI GCAATG 1 cut(s) 541
BseDI CCNNGG 4 cut(s) 121, 297, 357, 424
BseGI GGATG 1 cut(s) 82
BseLI CCNNNNNNNGG 1 cut(s) 572
BseMI GCAATG 1 cut(s) 541
BseMII CTCAG 3 cut(s) 306, 532, 561
BseNI ACTGG 3 cut(s) 349, 628, 649
BshFI GGCC 4 cut(s) 104, 288, 390, 473
BshNI GGYRCC 2 cut(s) 319, 353
BsiHKAI GWGCWC 1 cut(s) 404
BsiHKCI CYCGRG 1 cut(s) 600
BslI CCNNNNNNNGG 1 cut(s) 572
BsmAI GTCTC 1 cut(s) 182
BsnI GGCC 4 cut(s) 104, 288, 390, 473
BsoBI CYCGRG 1 cut(s) 600
Bsp1286I GDGCHC 1 cut(s) 404
Bsp143I GATC 1 cut(s) 373
Bsp1720I GCTNAGC 1 cut(s) 248
BspACI CCGC 2 cut(s) 539, 582
BspANI GGCC 4 cut(s) 104, 288, 390, 473
BspCNI CTCAG 3 cut(s) 307, 531, 560
BspHI TCATGA 2 cut(s) 271, 363
BspLI GGNNCC 2 cut(s) 321, 355
BspOI GCTAGC 1 cut(s) 621
BspPI GGATC 1 cut(s) 368
BspT107I GGYRCC 2 cut(s) 319, 353
BsrDI GCAATG 1 cut(s) 541
BsrI ACTGG 3 cut(s) 349, 628, 649
BssECI CCNNGG 4 cut(s) 121, 297, 357, 424
BssMI GATC 1 cut(s) 373
BssT1I CCWWGG 1 cut(s) 424
Bst4CI ACNGT 3 cut(s) 197, 210, 358
BstC8I GCNNGC 2 cut(s) 584, 619
BstDEI CTNAG 5 cut(s) 248, 315, 405, 518, 547
BstDSI CCRYGG 2 cut(s) 297, 357
BstF5I GGATG 1 cut(s) 82
BstHHI GCGC 1 cut(s) 534
BstKTI GATC 1 cut(s) 376
BstMAI GTCTC 1 cut(s) 182
BstMBI GATC 1 cut(s) 373
BstSFI CTRYAG 1 cut(s) 438
BstV2I GAAGAC 1 cut(s) 670
BsuRI GGCC 4 cut(s) 104, 288, 390, 473
BtgI CCRYGG 2 cut(s) 297, 357
BtsCI GGATG 1 cut(s) 82
BtsIMutI CAGTG 1 cut(s) 526
Cac8I GCNNGC 2 cut(s) 584, 619
CciI TCATGA 2 cut(s) 271, 363
CfoI GCGC 1 cut(s) 534
Cfr13I GGNCC 1 cut(s) 389
Csp6I GTAC 1 cut(s) 8
CviAII CATG 5 cut(s) 227, 272, 340, 364, 614
CviQI GTAC 1 cut(s) 8
DdeI CTNAG 5 cut(s) 248, 315, 405, 518, 547
DpnI GATC 1 cut(s) 375
DpnII GATC 1 cut(s) 373
DraIII CACNNNGTG 1 cut(s) 452
EaeI YGGCCR 2 cut(s) 102, 286
Ecl136II GAGCTC 1 cut(s) 402
Eco130I CCWWGG 1 cut(s) 424
Eco24I GRGCYC 1 cut(s) 404
Eco53kI GAGCTC 1 cut(s) 402
Eco57I CTGAAG 1 cut(s) 168
Eco88I CYCGRG 1 cut(s) 600
EcoICRI GAGCTC 1 cut(s) 402
EcoT14I CCWWGG 1 cut(s) 424
EcoT38I GRGCYC 1 cut(s) 404
ErhI CCWWGG 1 cut(s) 424
FaeI CATG 5 cut(s) 230, 275, 343, 367, 617
FatI CATG 5 cut(s) 226, 271, 339, 363, 613
FauI CCCGC 1 cut(s) 575
FokI GGATG 1 cut(s) 69
FriOI GRGCYC 1 cut(s) 404
FspBI CTAG 4 cut(s) 5, 35, 410, 618
GlaI GCGC 1 cut(s) 533
GsuI CTGGAG 1 cut(s) 666
HaeIII GGCC 4 cut(s) 104, 288, 390, 473
HhaI GCGC 1 cut(s) 534
Hin1II CATG 5 cut(s) 230, 275, 343, 367, 617
Hin6I GCGC 1 cut(s) 532
HinP1I GCGC 1 cut(s) 532
HphI GGTGA 1 cut(s) 617
Hpy188I TCNGA 3 cut(s) 187, 416, 593
Hpy188III TCNNGA 3 cut(s) 204, 272, 364
HpyAV CCTTC 3 cut(s) 74, 166, 488
HpyCH4III ACNGT 3 cut(s) 197, 210, 358
HpyF3I CTNAG 5 cut(s) 248, 315, 405, 518, 547
Hsp92II CATG 5 cut(s) 230, 275, 343, 367, 617
HspAI GCGC 1 cut(s) 532
Kzo9I GATC 1 cut(s) 373
LpnPI CCDG 3 cut(s) 330, 630, 641
LweI GCATC 2 cut(s) 552, 640
MaeI CTAG 4 cut(s) 5, 35, 410, 618
MaeIII GTNAC 1 cut(s) 178
MalI GATC 1 cut(s) 375
MboI GATC 1 cut(s) 373
MboII GAAGA 4 cut(s) 151, 154, 248, 670
MhlI GDGCHC 1 cut(s) 404
MlsI TGGCCA 1 cut(s) 104
MluCI AATT 1 cut(s) 478
MluNI TGGCCA 1 cut(s) 104
MmeI TCCRAC 1 cut(s) 394
MnlI CCTC 7 cut(s) 96, 122, 131, 176, 310, 448, 549
Mox20I TGGCCA 1 cut(s) 104
MscI TGGCCA 1 cut(s) 104
MseI TTAA 4 cut(s) 41, 306, 633, 688
MslI CAYNNNNRTG 1 cut(s) 338
Msp20I TGGCCA 1 cut(s) 104
NdeII GATC 1 cut(s) 373
NheI GCTAGC 1 cut(s) 617
NlaIII CATG 5 cut(s) 230, 275, 343, 367, 617
NlaIV GGNNCC 2 cut(s) 321, 355
NmuCI GTSAC 1 cut(s) 178
PagI TCATGA 2 cut(s) 271, 363
Psp124BI GAGCTC 1 cut(s) 404
PspN4I GGNNCC 2 cut(s) 321, 355
PspPI GGNCC 1 cut(s) 389
RsaI GTAC 1 cut(s) 9
RsaNI GTAC 1 cut(s) 8
RseI CAYNNNNRTG 1 cut(s) 338
SacI GAGCTC 1 cut(s) 404
SaqAI TTAA 4 cut(s) 41, 306, 633, 688
Sau3AI GATC 1 cut(s) 373
Sau96I GGNCC 1 cut(s) 389
SduI GDGCHC 1 cut(s) 404
SetI ASST 8 cut(s) 76, 249, 404, 411, 430, 445, 459, 577
SfaNI GCATC 2 cut(s) 552, 640
SfcI CTRYAG 1 cut(s) 438
SmiMI CAYNNNNRTG 1 cut(s) 338
SmlI CTYRAG 1 cut(s) 202
SmoI CTYRAG 1 cut(s) 202
SpeI ACTAGT 1 cut(s) 34
Sse9I AATT 1 cut(s) 478
SsiI CCGC 2 cut(s) 539, 582
SspMI CTAG 4 cut(s) 5, 35, 410, 618
SstI GAGCTC 1 cut(s) 404
StyI CCWWGG 1 cut(s) 424
TaaI ACNGT 3 cut(s) 197, 210, 358
TaqI TCGA 1 cut(s) 398
TasI AATT 1 cut(s) 478
TatI WGTACW 1 cut(s) 7
Tru1I TTAA 4 cut(s) 41, 306, 633, 688
Tru9I TTAA 4 cut(s) 41, 306, 633, 688
TscAI CASTG 1 cut(s) 526
TseFI GTSAC 1 cut(s) 178
Tsp45I GTSAC 1 cut(s) 178
TspDTI ATGAA 1 cut(s) 260
TspRI CASTG 1 cut(s) 526
XapI RAATTY 1 cut(s) 478
XspI CTAG 4 cut(s) 5, 35, 410, 618
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.