MD16G1010400.v1.1

component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is involved in protein synthesis of a specialized repertoire of mRNAs and, together with other initiation factors, stimulates binding of mRNA and methionyl-tRNAi to the 40S ribosome. The eIF-3 complex specifically targets and initiates translation of a subset of mRNAs involved in cell proliferation

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr16
Physical Location & Seq
Reverse (-)
811237 .. 812832
1596 bp
Loading structure...
UTR
Exon/CDS
Intron
MD16G1010400.v1.1.491

Sequence Viewer

Length: 264 bp
ATGTCTCCTCTTTGTGATCATGTGGTACTCGGCGGTGGTCAAGATGCATCAATGGTCACCACAACTGATCATCGTTCTGGGAAATTTGAAGCCAAATTCTATGACAAGATTCTTCAAGAAGAGATTGGAGGTGTTAAAGGACATTTTGGACCTATAAATGCTTTGGCGTTTAATCCCGATGGAAAAAGTTTCTCAAGCGGAGGTGAGGATGGTTACGTACGTCTACATCACTTTGATTCTGATTACTTCAACATCAAGATTTAG

Protein Analysis

88

Amino Acids

9.51

Weight (kDa)

5.6

Isoelectric Point (pI)

55.29

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
EIF3I PF24805 1 - 86 1.2e-43 EIF3I
WD40 PF00400 44 - 75 9.4e-08 WD domain, G-beta repeat
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 223
AciI CCGC 2 cut(s) 33, 198
AcsI RAATTY 2 cut(s) 83, 95
AfaI GTAC 2 cut(s) 27, 219
AgsI TTSAA 3 cut(s) 89, 116, 250
Alw26I GTCTC 1 cut(s) 9
ApoI RAATTY 2 cut(s) 83, 95
AspS9I GGNCC 1 cut(s) 149
AsuHPI GGTGA 2 cut(s) 49, 215
AvaII GGWCC 1 cut(s) 149
BccI CCATC 2 cut(s) 173, 203
BclI TGATCA 2 cut(s) 16, 67
BcoDI GTCTC 1 cut(s) 9
Bme18I GGWCC 1 cut(s) 149
BmgT120I GGNCC 1 cut(s) 149
BmsI GCATC 2 cut(s) 34, 56
BpuEI CTTGAG 1 cut(s) 178
BsaAI YACGTR 1 cut(s) 217
BseGI GGATG 1 cut(s) 214
BsiWI CGTACG 1 cut(s) 217
BsmAI GTCTC 1 cut(s) 9
Bsp143I GATC 2 cut(s) 16, 67
BspACI CCGC 2 cut(s) 33, 198
BssMI GATC 2 cut(s) 16, 67
Bst6I CTCTTC 1 cut(s) 114
BstBAI YACGTR 1 cut(s) 217
BstEII GGTNACC 1 cut(s) 55
BstF5I GGATG 1 cut(s) 214
BstKTI GATC 2 cut(s) 19, 70
BstMAI GTCTC 1 cut(s) 9
BstMBI GATC 2 cut(s) 16, 67
BstPI GGTNACC 1 cut(s) 55
BstSNI TACGTA 1 cut(s) 217
BtsCI GGATG 1 cut(s) 214
Cfr13I GGNCC 1 cut(s) 149
Csp6I GTAC 2 cut(s) 26, 218
CviAII CATG 1 cut(s) 20
CviJI RGCY 1 cut(s) 92
CviKI_1 RGCY 1 cut(s) 92
CviQI GTAC 2 cut(s) 26, 218
DpnI GATC 2 cut(s) 18, 69
DpnII GATC 2 cut(s) 16, 67
Eam1104I CTCTTC 1 cut(s) 114
EarI CTCTTC 1 cut(s) 114
Eco105I TACGTA 1 cut(s) 217
Eco47I GGWCC 1 cut(s) 149
Eco91I GGTNACC 1 cut(s) 55
EcoO65I GGTNACC 1 cut(s) 55
EcoT22I ATGCAT 1 cut(s) 49
FaeI CATG 1 cut(s) 23
FaiI YATR 3 cut(s) 21, 102, 155
FatI CATG 1 cut(s) 19
FbaI TGATCA 2 cut(s) 16, 67
FblI GTMKAC 1 cut(s) 223
FokI GGATG 1 cut(s) 221
Hin1II CATG 1 cut(s) 23
HinfI GANTC 2 cut(s) 109, 236
HphI GGTGA 2 cut(s) 49, 215
Hpy166II GTNNAC 1 cut(s) 224
Hpy188I TCNGA 1 cut(s) 241
Hpy188III TCNNGA 4 cut(s) 41, 116, 176, 256
Hpy8I GTNNAC 1 cut(s) 224
HpyCH4IV ACGT 2 cut(s) 216, 220
HpyCH4V TGCA 1 cut(s) 47
HpySE526I ACGT 2 cut(s) 216, 220
Hsp92II CATG 1 cut(s) 23
Ksp22I TGATCA 2 cut(s) 16, 67
Kzo9I GATC 2 cut(s) 16, 67
LpnPI CCDG 1 cut(s) 63
LweI GCATC 2 cut(s) 34, 56
MaeII ACGT 2 cut(s) 216, 220
MaeIII GTNAC 2 cut(s) 55, 212
MalI GATC 2 cut(s) 18, 69
MboI GATC 2 cut(s) 16, 67
MboII GAAGA 2 cut(s) 104, 131
MluCI AATT 2 cut(s) 83, 95
MnlI CCTC 4 cut(s) 18, 122, 194, 199
Mph1103I ATGCAT 1 cut(s) 49
MseI TTAA 2 cut(s) 135, 171
NdeII GATC 2 cut(s) 16, 67
NlaIII CATG 1 cut(s) 23
NmeAIII GCCGAG 1 cut(s) 9
NmuCI GTSAC 1 cut(s) 55
NsiI ATGCAT 1 cut(s) 49
PfeI GAWTC 2 cut(s) 109, 236
Pfl23II CGTACG 1 cut(s) 217
Ppu21I YACGTR 1 cut(s) 217
PspEI GGTNACC 1 cut(s) 55
PspLI CGTACG 1 cut(s) 217
PspPI GGNCC 1 cut(s) 149
RsaI GTAC 2 cut(s) 27, 219
RsaNI GTAC 2 cut(s) 26, 218
SaqAI TTAA 2 cut(s) 135, 171
Sau3AI GATC 2 cut(s) 16, 67
Sau96I GGNCC 1 cut(s) 149
SetI ASST 5 cut(s) 133, 154, 205, 219, 223
SfaNI GCATC 2 cut(s) 34, 56
SgeI CNNG 8 cut(s) 32, 41, 53, 90, 118, 128, 188, 207
SinI GGWCC 1 cut(s) 149
SmlI CTYRAG 1 cut(s) 193
SmoI CTYRAG 1 cut(s) 193
SnaBI TACGTA 1 cut(s) 217
Sse9I AATT 2 cut(s) 83, 95
SsiI CCGC 2 cut(s) 33, 198
TaiI ACGT 2 cut(s) 219, 223
TasI AATT 2 cut(s) 83, 95
TfiI GAWTC 2 cut(s) 109, 236
Tru1I TTAA 2 cut(s) 135, 171
Tru9I TTAA 2 cut(s) 135, 171
TseFI GTSAC 1 cut(s) 55
Tsp45I GTSAC 1 cut(s) 55
VpaK11BI GGWCC 1 cut(s) 149
XapI RAATTY 2 cut(s) 83, 95
XmiI GTMKAC 1 cut(s) 223
Zsp2I ATGCAT 1 cut(s) 49
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.