Rmu_ssc0000253.1_g000008

component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is involved in protein synthesis of a specialized repertoire of mRNAs and, together with other initiation factors, stimulates binding of mRNA and methionyl-tRNAi to the 40S ribosome. The eIF-3 complex specifically targets and initiates translation of a subset of mRNAs involved in cell proliferation

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_ssc0000253.1
Physical Location & Seq
Forward (+)
30983 .. 32252
1270 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_ssc0000253.1_g000008.1.cds

Sequence Viewer

Length: 543 bp
atgaagataaacagagctgtttgggggccgttgaacagcactatcataagcgccggagaagatgctgtcattcgtatctgggattctgagactggaaaactacttcaagagaaccagaaggaagagggtcacacgaaaacgatcacttcactagttaaatctccggatggttcacactttctaaccggttcccttgataaatctgcgaagctttgggatactagaacattgactcttatcaagacataccggactgagagtccagtcaatgcagttgcaatgtcgcctcttctcaatcatgttgtacttggtggtggtcaggatgcaatcaatgtcaccacaactgatcatcgtgctgggaaattcgaagccaaattctatgacaagattcttcaagaagagattggaggtgttaaagggcattttggacctattaatgctttggctttcaaccctgatggtaaaagtttctcaagtggaggtgaagatggttacatacgtctacatcacttcgaccatgattacttcaacatcaagatttag

Protein Analysis

180

Amino Acids

19.82

Weight (kDa)

6.44

Isoelectric Point (pI)

36.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 502
AccIII TCCGGA 1 cut(s) 163
AcsI RAATTY 2 cut(s) 362, 374
AfaI GTAC 1 cut(s) 306
AgeI ACCGGT 1 cut(s) 185
AgsI TTSAA 5 cut(s) 34, 107, 395, 451, 529
AhdI GACNNNNNGTC 1 cut(s) 258
AhlI ACTAGT 1 cut(s) 151
AluBI AGCT 2 cut(s) 17, 211
AluI AGCT 2 cut(s) 17, 211
Alw26I GTCTC 1 cut(s) 83
Aor13HI TCCGGA 1 cut(s) 163
AoxI GGCC 1 cut(s) 26
ApoI RAATTY 2 cut(s) 362, 374
AseI ATTAAT 1 cut(s) 435
AsiGI ACCGGT 1 cut(s) 185
AspLEI GCGC 1 cut(s) 53
AspS9I GGNCC 2 cut(s) 26, 428
AsuHPI GGTGA 2 cut(s) 328, 494
AsuII TTCGAA 1 cut(s) 366
AvaII GGWCC 1 cut(s) 428
BccI CCATC 3 cut(s) 161, 452, 482
BceAI ACGGC 1 cut(s) 13
BciVI GTATCC 1 cut(s) 211
BclI TGATCA 1 cut(s) 346
BcoDI GTCTC 1 cut(s) 83
BcuI ACTAGT 1 cut(s) 151
BfaI CTAG 2 cut(s) 152, 222
BfoI RGCGCY 1 cut(s) 54
BfuI GTATCC 1 cut(s) 211
Bme18I GGWCC 1 cut(s) 428
BmeRI GACNNNNNGTC 1 cut(s) 258
BmgT120I GGNCC 2 cut(s) 26, 428
BmiI GGNNCC 2 cut(s) 27, 190
BmsI GCATC 2 cut(s) 52, 313
Bpu14I TTCGAA 1 cut(s) 366
BpuEI CTTGAG 1 cut(s) 457
BsaWI WCCGGW 3 cut(s) 163, 185, 249
Bse118I RCCGGY 1 cut(s) 185
Bse1I ACTGG 2 cut(s) 97, 263
Bse3DI GCAATG 1 cut(s) 285
BseAI TCCGGA 1 cut(s) 163
BseGI GGATG 2 cut(s) 172, 328
BseMI GCAATG 1 cut(s) 285
BseMII CTCAG 2 cut(s) 78, 246
BseNI ACTGG 2 cut(s) 97, 263
BseYI CCCAGC 1 cut(s) 356
BshFI GGCC 1 cut(s) 28
BshTI ACCGGT 1 cut(s) 185
BsiSI CCGG 4 cut(s) 54, 164, 186, 250
BsmAI GTCTC 1 cut(s) 83
BsnI GGCC 1 cut(s) 28
Bsp119I TTCGAA 1 cut(s) 366
Bsp13I TCCGGA 1 cut(s) 163
Bsp143I GATC 2 cut(s) 141, 346
BspANI GGCC 1 cut(s) 28
BspCNI CTCAG 2 cut(s) 79, 247
BspEI TCCGGA 1 cut(s) 163
BspLI GGNNCC 2 cut(s) 27, 190
BspT104I TTCGAA 1 cut(s) 366
BsrDI GCAATG 1 cut(s) 285
BsrFI RCCGGY 1 cut(s) 185
BsrI ACTGG 2 cut(s) 97, 263
BssAI RCCGGY 1 cut(s) 185
BssMI GATC 2 cut(s) 141, 346
Bst6I CTCTTC 3 cut(s) 117, 294, 393
BstBI TTCGAA 1 cut(s) 366
BstDEI CTNAG 2 cut(s) 87, 255
BstF5I GGATG 2 cut(s) 172, 328
BstH2I RGCGCY 1 cut(s) 54
BstHHI GCGC 1 cut(s) 53
BstKTI GATC 2 cut(s) 144, 349
BstMAI GTCTC 1 cut(s) 83
BstMBI GATC 2 cut(s) 141, 346
BsuI GTATCC 1 cut(s) 211
BsuRI GGCC 1 cut(s) 28
BtsCI GGATG 2 cut(s) 172, 328
CfoI GCGC 1 cut(s) 53
Cfr10I RCCGGY 1 cut(s) 185
Cfr13I GGNCC 2 cut(s) 26, 428
Csp6I GTAC 1 cut(s) 305
CspAI ACCGGT 1 cut(s) 185
CviAII CATG 2 cut(s) 299, 518
CviJI RGCY 5 cut(s) 17, 28, 211, 371, 446
CviKI_1 RGCY 5 cut(s) 17, 28, 211, 371, 446
CviQI GTAC 1 cut(s) 305
DdeI CTNAG 2 cut(s) 87, 255
DpnI GATC 2 cut(s) 143, 348
DpnII GATC 2 cut(s) 141, 346
DriI GACNNNNNGTC 1 cut(s) 258
Eam1104I CTCTTC 3 cut(s) 117, 294, 393
Eam1105I GACNNNNNGTC 1 cut(s) 258
EarI CTCTTC 3 cut(s) 117, 294, 393
Eco47I GGWCC 1 cut(s) 428
FaeI CATG 2 cut(s) 302, 521
FaiI YATR 6 cut(s) 47, 247, 300, 381, 497, 519
FatI CATG 2 cut(s) 298, 517
FbaI TGATCA 1 cut(s) 346
FblI GTMKAC 1 cut(s) 502
FokI GGATG 2 cut(s) 179, 335
FspBI CTAG 2 cut(s) 152, 222
GlaI GCGC 1 cut(s) 52
GsaI CCCAGC 1 cut(s) 360
HaeII RGCGCY 1 cut(s) 54
HaeIII GGCC 1 cut(s) 28
HapII CCGG 4 cut(s) 54, 164, 186, 250
HhaI GCGC 1 cut(s) 53
Hin1II CATG 2 cut(s) 302, 521
Hin6I GCGC 1 cut(s) 51
HinP1I GCGC 1 cut(s) 51
HindIII AAGCTT 1 cut(s) 209
HinfI GANTC 4 cut(s) 83, 232, 259, 388
HpaII CCGG 4 cut(s) 54, 164, 186, 250
HphI GGTGA 2 cut(s) 328, 494
Hpy166II GTNNAC 2 cut(s) 173, 503
Hpy188I TCNGA 1 cut(s) 88
Hpy188III TCNNGA 6 cut(s) 107, 164, 241, 320, 395, 535
Hpy8I GTNNAC 2 cut(s) 173, 503
HpyAV CCTTC 1 cut(s) 112
HpyCH4IV ACGT 1 cut(s) 499
HpyCH4V TGCA 3 cut(s) 272, 278, 326
HpyF3I CTNAG 2 cut(s) 87, 255
HpySE526I ACGT 1 cut(s) 499
Hsp92II CATG 2 cut(s) 302, 521
HspAI GCGC 1 cut(s) 51
Kpn2I TCCGGA 1 cut(s) 163
Ksp22I TGATCA 1 cut(s) 346
Kzo9I GATC 2 cut(s) 141, 346
LweI GCATC 2 cut(s) 52, 313
MaeI CTAG 2 cut(s) 152, 222
MaeII ACGT 1 cut(s) 499
MaeIII GTNAC 3 cut(s) 128, 334, 491
MalI GATC 2 cut(s) 143, 348
MboI GATC 2 cut(s) 141, 346
MboII GAAGA 7 cut(s) 16, 71, 134, 281, 383, 410, 497
MluCI AATT 2 cut(s) 362, 374
MlyI GAGTC 2 cut(s) 226, 268
MnlI CCTC 4 cut(s) 118, 297, 401, 473
MroI TCCGGA 1 cut(s) 163
MseI TTAA 3 cut(s) 156, 414, 435
MspI CCGG 4 cut(s) 54, 164, 186, 250
NdeII GATC 2 cut(s) 141, 346
NlaIII CATG 2 cut(s) 302, 521
NlaIV GGNNCC 2 cut(s) 27, 190
NmuCI GTSAC 2 cut(s) 128, 334
NspV TTCGAA 1 cut(s) 366
PfeI GAWTC 2 cut(s) 83, 388
PinAI ACCGGT 1 cut(s) 185
PleI GAGTC 2 cut(s) 226, 267
PpsI GAGTC 2 cut(s) 226, 267
PshBI ATTAAT 1 cut(s) 435
PspFI CCCAGC 1 cut(s) 356
PspN4I GGNNCC 2 cut(s) 27, 190
PspPI GGNCC 2 cut(s) 26, 428
RsaI GTAC 1 cut(s) 306
RsaNI GTAC 1 cut(s) 305
SaqAI TTAA 3 cut(s) 156, 414, 435
Sau3AI GATC 2 cut(s) 141, 346
Sau96I GGNCC 2 cut(s) 26, 428
SchI GAGTC 2 cut(s) 226, 268
SetI ASST 6 cut(s) 19, 213, 412, 433, 484, 502
SfaNI GCATC 2 cut(s) 52, 313
SfuI TTCGAA 1 cut(s) 366
SinI GGWCC 1 cut(s) 428
SmlI CTYRAG 1 cut(s) 472
SmoI CTYRAG 1 cut(s) 472
SpeI ACTAGT 1 cut(s) 151
Sse9I AATT 2 cut(s) 362, 374
SspMI CTAG 2 cut(s) 152, 222
TaiI ACGT 1 cut(s) 502
TaqI TCGA 2 cut(s) 366, 513
TasI AATT 2 cut(s) 362, 374
TatI WGTACW 1 cut(s) 304
TfiI GAWTC 2 cut(s) 83, 388
Tru1I TTAA 3 cut(s) 156, 414, 435
Tru9I TTAA 3 cut(s) 156, 414, 435
TseFI GTSAC 2 cut(s) 128, 334
Tsp45I GTSAC 2 cut(s) 128, 334
TspDTI ATGAA 1 cut(s) 17
VpaK11BI GGWCC 1 cut(s) 428
VspI ATTAAT 1 cut(s) 435
XapI RAATTY 2 cut(s) 362, 374
XmiI GTMKAC 1 cut(s) 502
XspI CTAG 2 cut(s) 152, 222
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.