Prupe.1G092100_v2.0.a1
ERF Family

Belongs to the small GTPase superfamily. Arf family

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
Physical Location & Seq
Forward (+)
6967051 .. 6973875
6825 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G092100.1

Sequence Viewer

Length: 549 bp
ATGGGCATTTTGTTTACTAAAATGTTCGCTTCCTTGTTTGGGAACAAGGAAGCTCGGATCCTTGTCCTTGGATTGGACAATGCTGGGAAAACTACTATTCTCTATCGGCTCCAGATGGGGGAGGTTGTCTCCACGATCCCAACCATTGGATTTAATGTTGAGACAGTGCAATATAACAACATCAAATTCCAAGTCTGGGATCTCGGTGGACAGACAAGTATCAGGCCATATTGGAGATGCTATTTTCCAAATACTCAGGCCATAATCTATGTTGTTGATTCTAGCGACACTGACAGGCTGGTAATAGCGAAAGATGAGTTTCATGCAATATTAGAGGAGGAAGAGTTGAAAGGTGCGGTTGTCCTCATTTTTGCTAATAAGCAGGATCTACCTGGTGCGCTTGATGATGCTGCAATAACTGAGGCTTTAGAGTTGCACAAGATAAAAAACCGTCAGTGGGCTATTTTTAAAACTTCTGCCATAAAAGGGGAAGGTCTATTTGAGGGCTTAGACTGGTTGAGTAACACACTCAAGTCTGGAGGAGGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

183

Amino Acids

20.29

Weight (kDa)

5.24

Isoelectric Point (pI)

27.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 146
AciI CCGC 1 cut(s) 356
AclWI GGATC 5 cut(s) 52, 65, 130, 207, 393
AcsI RAATTY 1 cut(s) 185
AfiI CCNNNNNNNGG 7 cut(s) 39, 73, 118, 146, 196, 457, 486
AgsI TTSAA 1 cut(s) 349
AjnI CCWGG 1 cut(s) 391
AluBI AGCT 1 cut(s) 53
AluI AGCT 1 cut(s) 53
Alw26I GTCTC 2 cut(s) 133, 155
AlwI GGATC 5 cut(s) 52, 65, 130, 207, 393
AoxI GGCC 2 cut(s) 224, 258
ApeKI GCWGC 1 cut(s) 410
ApoI RAATTY 1 cut(s) 185
ArsI GACNNNNNNTTYG 2 cut(s) 177, 209
AspLEI GCGC 1 cut(s) 400
BamHI GGATCC 1 cut(s) 57
BbvI GCAGC 1 cut(s) 397
BccI CCATC 1 cut(s) 109
BciT130I CCWGG 1 cut(s) 393
BcoDI GTCTC 2 cut(s) 133, 155
BfaI CTAG 1 cut(s) 282
BisI GCNGC 1 cut(s) 411
BlsI GCNGC 1 cut(s) 412
Bme1390I CCNGG 1 cut(s) 393
BmiI GGNNCC 2 cut(s) 59, 110
BmrFI CCNGG 1 cut(s) 393
BmsI GCATC 2 cut(s) 227, 397
BplI GAGNNNNNCTC 2 cut(s) 113, 145
BpmI CTGGAG 1 cut(s) 95
BpuEI CTTGAG 1 cut(s) 515
BsaJI CCNNGG 1 cut(s) 67
BsaXI ACNNNNNCTCC 2 cut(s) 329, 359
Bsc4I CCNNNNNNNGG 7 cut(s) 39, 73, 118, 146, 196, 457, 486
Bse1I ACTGG 1 cut(s) 518
BseBI CCWGG 1 cut(s) 393
BseDI CCNNGG 1 cut(s) 67
BseLI CCNNNNNNNGG 7 cut(s) 39, 73, 118, 146, 196, 457, 486
BseMII CTCAG 2 cut(s) 269, 411
BseNI ACTGG 1 cut(s) 518
BseRI GAGGAG 1 cut(s) 350
BseXI GCAGC 1 cut(s) 397
BseYI CCCAGC 1 cut(s) 83
BshFI GGCC 2 cut(s) 226, 260
BslI CCNNNNNNNGG 7 cut(s) 39, 73, 118, 146, 196, 457, 486
BsmAI GTCTC 2 cut(s) 133, 155
BsnI GGCC 2 cut(s) 226, 260
Bsp143I GATC 4 cut(s) 57, 135, 199, 385
BspACI CCGC 1 cut(s) 356
BspANI GGCC 2 cut(s) 226, 260
BspCNI CTCAG 2 cut(s) 268, 412
BspLI GGNNCC 2 cut(s) 59, 110
BspPI GGATC 5 cut(s) 52, 65, 130, 207, 393
BsrI ACTGG 1 cut(s) 518
BssECI CCNNGG 1 cut(s) 67
BssMI GATC 4 cut(s) 57, 135, 199, 385
BssT1I CCWWGG 1 cut(s) 67
Bst2UI CCWGG 1 cut(s) 393
Bst4CI ACNGT 2 cut(s) 166, 452
Bst6I CTCTTC 1 cut(s) 336
BstDEI CTNAG 3 cut(s) 255, 420, 508
BstHHI GCGC 1 cut(s) 400
BstKTI GATC 4 cut(s) 60, 138, 202, 388
BstMAI GTCTC 2 cut(s) 133, 155
BstMBI GATC 4 cut(s) 57, 135, 199, 385
BstNI CCWGG 1 cut(s) 393
BstSCI CCNGG 1 cut(s) 391
BstV1I GCAGC 1 cut(s) 397
BstX2I RGATCY 3 cut(s) 57, 199, 385
BstYI RGATCY 3 cut(s) 57, 199, 385
BsuRI GGCC 2 cut(s) 226, 260
BtsIMutI CAGTG 3 cut(s) 171, 288, 461
CfoI GCGC 1 cut(s) 400
CsiI ACCWGGT 1 cut(s) 391
CviAII CATG 1 cut(s) 323
CviJI RGCY 9 cut(s) 53, 109, 226, 260, 298, 425, 461, 507, 546
CviKI_1 RGCY 9 cut(s) 53, 109, 226, 260, 298, 425, 461, 507, 546
DdeI CTNAG 3 cut(s) 255, 420, 508
DpnI GATC 4 cut(s) 59, 137, 201, 387
DpnII GATC 4 cut(s) 57, 135, 199, 385
DraI TTTAAA 1 cut(s) 469
Eam1104I CTCTTC 1 cut(s) 336
EarI CTCTTC 1 cut(s) 336
Eco130I CCWWGG 1 cut(s) 67
EcoRII CCWGG 1 cut(s) 391
EcoT14I CCWWGG 1 cut(s) 67
ErhI CCWWGG 1 cut(s) 67
FaeI CATG 1 cut(s) 326
FaiI YATR 6 cut(s) 174, 229, 263, 270, 324, 482
FatI CATG 1 cut(s) 322
Fnu4HI GCNGC 1 cut(s) 411
Fsp4HI GCNGC 1 cut(s) 411
FspBI CTAG 1 cut(s) 282
GlaI GCGC 1 cut(s) 399
GluI GCNGC 1 cut(s) 411
GsaI CCCAGC 1 cut(s) 87
GsuI CTGGAG 1 cut(s) 95
HaeIII GGCC 2 cut(s) 226, 260
HhaI GCGC 1 cut(s) 400
Hin1II CATG 1 cut(s) 326
Hin6I GCGC 1 cut(s) 398
HinP1I GCGC 1 cut(s) 398
HinfI GANTC 1 cut(s) 278
Hpy166II GTNNAC 2 cut(s) 15, 209
Hpy188I TCNGA 1 cut(s) 57
Hpy188III TCNNGA 2 cut(s) 112, 537
Hpy8I GTNNAC 2 cut(s) 15, 209
HpyAV CCTTC 1 cut(s) 485
HpyCH4III ACNGT 2 cut(s) 166, 452
HpyCH4V TGCA 4 cut(s) 169, 326, 413, 436
HpyF3I CTNAG 3 cut(s) 255, 420, 508
Hsp92II CATG 1 cut(s) 326
HspAI GCGC 1 cut(s) 398
Kzo9I GATC 4 cut(s) 57, 135, 199, 385
LmnI GCTCC 1 cut(s) 114
Lsp1109I GCAGC 1 cut(s) 397
LweI GCATC 2 cut(s) 227, 397
MabI ACCWGGT 1 cut(s) 391
MaeI CTAG 1 cut(s) 282
MaeIII GTNAC 1 cut(s) 521
MalI GATC 4 cut(s) 59, 137, 201, 387
MboI GATC 4 cut(s) 57, 135, 199, 385
MboII GAAGA 1 cut(s) 353
MflI RGATCY 3 cut(s) 57, 199, 385
MluCI AATT 1 cut(s) 185
MnlI CCTC 8 cut(s) 115, 328, 331, 374, 415, 496, 533, 536
MseI TTAA 2 cut(s) 153, 468
MspR9I CCNGG 1 cut(s) 393
MvaI CCWGG 1 cut(s) 393
NdeII GATC 4 cut(s) 57, 135, 199, 385
NlaIII CATG 1 cut(s) 326
NlaIV GGNNCC 2 cut(s) 59, 110
PfeI GAWTC 1 cut(s) 278
PflMI CCANNNNNTGG 1 cut(s) 146
PkrI GCNGC 1 cut(s) 412
Psp6I CCWGG 1 cut(s) 391
PspFI CCCAGC 1 cut(s) 83
PspGI CCWGG 1 cut(s) 391
PspN4I GGNNCC 2 cut(s) 59, 110
PsuI RGATCY 3 cut(s) 57, 199, 385
SaqAI TTAA 2 cut(s) 153, 468
SatI GCNGC 1 cut(s) 411
Sau3AI GATC 4 cut(s) 57, 135, 199, 385
ScrFI CCNGG 1 cut(s) 393
SetI ASST 5 cut(s) 55, 126, 355, 394, 496
SexAI ACCWGGT 1 cut(s) 391
SfaNI GCATC 2 cut(s) 227, 397
SmlI CTYRAG 1 cut(s) 530
SmoI CTYRAG 1 cut(s) 530
Sse9I AATT 1 cut(s) 185
SsiI CCGC 1 cut(s) 356
SspI AATATT 1 cut(s) 330
SspMI CTAG 1 cut(s) 282
StyD4I CCNGG 1 cut(s) 391
StyI CCWWGG 1 cut(s) 67
TaaI ACNGT 2 cut(s) 166, 452
TasI AATT 1 cut(s) 185
TfiI GAWTC 1 cut(s) 278
Tru1I TTAA 2 cut(s) 153, 468
Tru9I TTAA 2 cut(s) 153, 468
TscAI CASTG 3 cut(s) 171, 295, 461
TseI GCWGC 1 cut(s) 410
TspDTI ATGAA 1 cut(s) 311
TspRI CASTG 3 cut(s) 171, 295, 461
Van91I CCANNNNNTGG 1 cut(s) 146
XapI RAATTY 1 cut(s) 185
XspI CTAG 1 cut(s) 282
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.