Rh4DG112600
ERF Family

Belongs to the small GTPase superfamily. Arf family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
OG0002882
Physical Location & Seq
Forward (+)
17769417 .. 17772485
3069 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG112600.1

Sequence Viewer

Length: 372 bp
ATGGGCATTTTGTTCACGAAAATGTTCTCTTCCCTTTTTGGGAACAAGGAGGCTCGGATCCTCGTCCTCGGATTGGACAATGCTGGCAAAACCACTATTCTATATCGGCTACAGATGGGGGAGGTTGTGTCCACAATTCCAACGATTGGATTCAATGTTGAGACAGTGCAGTACAACAACATCAAATTCCAAGTATGGGATCTCGGTGGACAGACAAGTATCAGGCCATATTGGAGATGCTATTTTCCAAATACTCAAGCCATAATCTATGTTGTTGACTCTAGCGACACTGACAGGCTGGTAATAGCTAAAGAGGAGTTTCATGCTATCTTGGAGGTAACCGACTGTGGGTTTACACATTTACAAAGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Arf

Protein Analysis

123

Amino Acids

13.96

Weight (kDa)

5.57

Isoelectric Point (pI)

32.58

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Arf PF00025 5 - 113 4.9e-52 ADP-ribosylation factor family
SRPRB PF09439 16 - 107 1.5e-08 Signal recognition particle receptor beta subunit
Roc PF08477 19 - 99 1.7e-12 Ras of Complex, Roc, domain of DAPkinase
Gtr1_RagA PF04670 19 - 111 3.4e-08 Gtr1/RagA G protein conserved region
Ras PF00071 19 - 101 1.4e-07 Ras family
G-alpha PF00503 45 - 105 3.9e-09 G-protein alpha subunit
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 146
AclWI GGATC 3 cut(s) 52, 65, 207
AcsI RAATTY 1 cut(s) 185
AfaI GTAC 1 cut(s) 173
AfiI CCNNNNNNNGG 5 cut(s) 39, 73, 146, 196, 348
AgsI TTSAA 1 cut(s) 154
AluBI AGCT 1 cut(s) 308
AluI AGCT 1 cut(s) 308
Alw26I GTCTC 1 cut(s) 155
AlwI GGATC 3 cut(s) 52, 65, 207
AoxI GGCC 1 cut(s) 224
ApoI RAATTY 1 cut(s) 185
Asp700I GAANNNNTTC 1 cut(s) 23
BamHI GGATCC 1 cut(s) 57
BccI CCATC 1 cut(s) 109
BcoDI GTCTC 1 cut(s) 155
BfaI CTAG 1 cut(s) 282
BfmI CTRYAG 1 cut(s) 110
BmiI GGNNCC 1 cut(s) 59
BmsI GCATC 1 cut(s) 227
BpuEI CTTGAG 1 cut(s) 240
BsaJI CCNNGG 1 cut(s) 67
BsaXI ACNNNNNCTCC 2 cut(s) 113, 143
Bsc4I CCNNNNNNNGG 5 cut(s) 39, 73, 146, 196, 348
BseDI CCNNGG 1 cut(s) 67
BseLI CCNNNNNNNGG 5 cut(s) 39, 73, 146, 196, 348
BseRI GAGGAG 1 cut(s) 329
BsgI GTGCAG 1 cut(s) 188
BshFI GGCC 1 cut(s) 226
BslI CCNNNNNNNGG 5 cut(s) 39, 73, 146, 196, 348
BsmAI GTCTC 1 cut(s) 155
BsnI GGCC 1 cut(s) 226
Bsp143I GATC 2 cut(s) 57, 199
BspANI GGCC 1 cut(s) 226
BspLI GGNNCC 1 cut(s) 59
BspPI GGATC 3 cut(s) 52, 65, 207
BssECI CCNNGG 1 cut(s) 67
BssMI GATC 2 cut(s) 57, 199
Bst4CI ACNGT 2 cut(s) 166, 347
Bst6I CTCTTC 1 cut(s) 34
BstC8I GCNNGC 1 cut(s) 85
BstEII GGTNACC 1 cut(s) 337
BstKTI GATC 2 cut(s) 60, 202
BstMAI GTCTC 1 cut(s) 155
BstMBI GATC 2 cut(s) 57, 199
BstPI GGTNACC 1 cut(s) 337
BstSFI CTRYAG 1 cut(s) 110
BstX2I RGATCY 2 cut(s) 57, 199
BstYI RGATCY 2 cut(s) 57, 199
BsuRI GGCC 1 cut(s) 226
BtsIMutI CAGTG 2 cut(s) 171, 288
Cac8I GCNNGC 1 cut(s) 85
Csp6I GTAC 1 cut(s) 172
CviAII CATG 1 cut(s) 323
CviJI RGCY 6 cut(s) 53, 109, 226, 260, 298, 308
CviKI_1 RGCY 6 cut(s) 53, 109, 226, 260, 298, 308
CviQI GTAC 1 cut(s) 172
DpnI GATC 2 cut(s) 59, 201
DpnII GATC 2 cut(s) 57, 199
Eam1104I CTCTTC 1 cut(s) 34
EarI CTCTTC 1 cut(s) 34
Eco91I GGTNACC 1 cut(s) 337
EcoO65I GGTNACC 1 cut(s) 337
FaeI CATG 1 cut(s) 326
FaiI YATR 6 cut(s) 103, 196, 229, 263, 270, 324
FatI CATG 1 cut(s) 322
FspBI CTAG 1 cut(s) 282
HaeIII GGCC 1 cut(s) 226
Hin1II CATG 1 cut(s) 326
HincII GTYRAC 1 cut(s) 277
HindII GTYRAC 1 cut(s) 277
HinfI GANTC 2 cut(s) 150, 278
Hpy166II GTNNAC 5 cut(s) 15, 132, 209, 277, 354
Hpy188I TCNGA 2 cut(s) 57, 71
Hpy188III TCNNGA 1 cut(s) 16
Hpy8I GTNNAC 5 cut(s) 15, 132, 209, 277, 354
HpyCH4III ACNGT 2 cut(s) 166, 347
HpyCH4V TGCA 1 cut(s) 169
Hsp92II CATG 1 cut(s) 326
Kzo9I GATC 2 cut(s) 57, 199
LpnPI CCDG 4 cut(s) 69, 208, 280, 284
LweI GCATC 1 cut(s) 227
MaeI CTAG 1 cut(s) 282
MaeIII GTNAC 1 cut(s) 337
MalI GATC 2 cut(s) 59, 201
MboI GATC 2 cut(s) 57, 199
MboII GAAGA 1 cut(s) 21
MflI RGATCY 2 cut(s) 57, 199
MluCI AATT 2 cut(s) 135, 185
MlyI GAGTC 1 cut(s) 272
MmeI TCCRAC 1 cut(s) 164
MnlI CCTC 6 cut(s) 43, 71, 77, 115, 307, 328
MroXI GAANNNNTTC 1 cut(s) 23
MseI TTAA 1 cut(s) 370
MslI CAYNNNNRTG 1 cut(s) 20
NdeII GATC 2 cut(s) 57, 199
NlaIII CATG 1 cut(s) 326
NlaIV GGNNCC 1 cut(s) 59
PdmI GAANNNNTTC 1 cut(s) 23
PfeI GAWTC 1 cut(s) 150
PflMI CCANNNNNTGG 1 cut(s) 146
PleI GAGTC 1 cut(s) 272
PpsI GAGTC 1 cut(s) 272
PspEI GGTNACC 1 cut(s) 337
PspN4I GGNNCC 1 cut(s) 59
PsuI RGATCY 2 cut(s) 57, 199
RsaI GTAC 1 cut(s) 173
RsaNI GTAC 1 cut(s) 172
RseI CAYNNNNRTG 1 cut(s) 20
SaqAI TTAA 1 cut(s) 370
Sau3AI GATC 2 cut(s) 57, 199
SchI GAGTC 1 cut(s) 272
SetI ASST 3 cut(s) 126, 310, 339
SfaNI GCATC 1 cut(s) 227
SfcI CTRYAG 1 cut(s) 110
SmiMI CAYNNNNRTG 1 cut(s) 20
SmlI CTYRAG 1 cut(s) 255
SmoI CTYRAG 1 cut(s) 255
Sse9I AATT 2 cut(s) 135, 185
SspMI CTAG 1 cut(s) 282
TaaI ACNGT 2 cut(s) 166, 347
TasI AATT 2 cut(s) 135, 185
TatI WGTACW 1 cut(s) 171
TfiI GAWTC 1 cut(s) 150
Tru1I TTAA 1 cut(s) 370
Tru9I TTAA 1 cut(s) 370
TscAI CASTG 2 cut(s) 171, 295
TspDTI ATGAA 1 cut(s) 311
TspRI CASTG 2 cut(s) 171, 295
Van91I CCANNNNNTGG 1 cut(s) 146
XapI RAATTY 1 cut(s) 185
XmnI GAANNNNTTC 1 cut(s) 23
XspI CTAG 1 cut(s) 282
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.