Rw4G009740
ERF Family

Belongs to the small GTPase superfamily. Arf family

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr4
Physical Location & Seq
Forward (+)
21993752 .. 21999716
5965 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw4G009740.1

Sequence Viewer

Length: 549 bp
ATGGGCATTTTGTTCACGAAAATGTTCTCTTCCCTTTTTGGGAACAAGGAGGCTCGGATCCTCGTCCTCGGATTGGACAATGCTGGCAAAACCACTATTCTATATCGGCTACAGATGGGGGAGGTTGTGTCCACAATTCCAACGATTGGATTCAATGTTGAGACAGTGCAGTACAACAACATCAAATTCCAAGTATGGGATCTCGGTGGACAGACAAGTATCAGGCCATATTGGAGATGCTATTTTCCAAATACTCAAGCCATAATCTATGTTGTTGACTCTAGTGACACTGACAGGCTGGTAATAGCTAAAGAGGAGTTTCATGCTATCTTGGAGGAGGAAGAGTTGAAAGGTGCAGTTGTCCTTATTTTTGCCAATAAGCAGGATCTTCCTGGTGCACTTGATGATGCTGCAATAACTGAGGCCTTAGAGTTGCACAAGATAAAAAACCGTCAATGGTCTATCTTTAAAACTTCTGCCATAAAAGGCGAAGGTCTTTTTGAGGGCTTAGACTGGCTGAGTAACACACTGAAGTCTGGAGGTGGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

182

Amino Acids

20.34

Weight (kDa)

5.25

Isoelectric Point (pI)

31.16

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Arf PF00025 5 - 176 1.4e-79 ADP-ribosylation factor family
SRPRB PF09439 16 - 151 9.6e-13 Signal recognition particle receptor beta subunit
Roc PF08477 19 - 129 1e-13 Ras of Complex, Roc, domain of DAPkinase
Ras PF00071 19 - 170 4.5e-11 Ras family
Gtr1_RagA PF04670 19 - 130 5.8e-09 Gtr1/RagA G protein conserved region
G-alpha PF00503 44 - 130 3.7e-10 G-protein alpha subunit
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 146
AclWI GGATC 4 cut(s) 52, 65, 207, 393
AcsI RAATTY 1 cut(s) 185
AfaI GTAC 1 cut(s) 173
AfiI CCNNNNNNNGG 4 cut(s) 39, 73, 146, 196
AgsI TTSAA 2 cut(s) 154, 349
AjnI CCWGG 1 cut(s) 391
AluBI AGCT 1 cut(s) 308
AluI AGCT 1 cut(s) 308
Alw21I GWGCWC 1 cut(s) 400
Alw26I GTCTC 1 cut(s) 155
Alw44I GTGCAC 1 cut(s) 396
AlwI GGATC 4 cut(s) 52, 65, 207, 393
AoxI GGCC 2 cut(s) 224, 423
ApaLI GTGCAC 1 cut(s) 396
ApeKI GCWGC 1 cut(s) 410
ApoI RAATTY 1 cut(s) 185
Asp700I GAANNNNTTC 1 cut(s) 23
BaeGI GKGCMC 1 cut(s) 400
BamHI GGATCC 1 cut(s) 57
Bbv12I GWGCWC 1 cut(s) 400
BbvI GCAGC 1 cut(s) 397
BccI CCATC 1 cut(s) 109
BciT130I CCWGG 1 cut(s) 393
BcoDI GTCTC 1 cut(s) 155
BfaI CTAG 1 cut(s) 282
BfmI CTRYAG 1 cut(s) 110
BisI GCNGC 1 cut(s) 411
BlsI GCNGC 1 cut(s) 412
Bme1390I CCNGG 1 cut(s) 393
BmiI GGNNCC 1 cut(s) 59
BmrFI CCNGG 1 cut(s) 393
BmsI GCATC 2 cut(s) 227, 397
BpuEI CTTGAG 1 cut(s) 240
BsaJI CCNNGG 1 cut(s) 67
BsaXI ACNNNNNCTCC 4 cut(s) 113, 143, 329, 359
Bsc4I CCNNNNNNNGG 4 cut(s) 39, 73, 146, 196
Bse1I ACTGG 1 cut(s) 518
BseBI CCWGG 1 cut(s) 393
BseDI CCNNGG 1 cut(s) 67
BseLI CCNNNNNNNGG 4 cut(s) 39, 73, 146, 196
BseMII CTCAG 2 cut(s) 411, 509
BseNI ACTGG 1 cut(s) 518
BseRI GAGGAG 2 cut(s) 329, 350
BseSI GKGCMC 1 cut(s) 400
BseXI GCAGC 1 cut(s) 397
BsgI GTGCAG 2 cut(s) 188, 375
BshFI GGCC 2 cut(s) 226, 425
BsiHKAI GWGCWC 1 cut(s) 400
BslI CCNNNNNNNGG 4 cut(s) 39, 73, 146, 196
BsmAI GTCTC 1 cut(s) 155
BsnI GGCC 2 cut(s) 226, 425
Bsp1286I GDGCHC 1 cut(s) 400
Bsp143I GATC 3 cut(s) 57, 199, 385
BspANI GGCC 2 cut(s) 226, 425
BspCNI CTCAG 2 cut(s) 412, 510
BspLI GGNNCC 1 cut(s) 59
BspPI GGATC 4 cut(s) 52, 65, 207, 393
BsrI ACTGG 1 cut(s) 518
BssECI CCNNGG 1 cut(s) 67
BssMI GATC 3 cut(s) 57, 199, 385
Bst2UI CCWGG 1 cut(s) 393
Bst4CI ACNGT 2 cut(s) 166, 452
Bst6I CTCTTC 2 cut(s) 34, 336
BstC8I GCNNGC 1 cut(s) 85
BstDEI CTNAG 4 cut(s) 420, 427, 508, 518
BstKTI GATC 3 cut(s) 60, 202, 388
BstMAI GTCTC 1 cut(s) 155
BstMBI GATC 3 cut(s) 57, 199, 385
BstNI CCWGG 1 cut(s) 393
BstSCI CCNGG 1 cut(s) 391
BstSFI CTRYAG 1 cut(s) 110
BstSLI GKGCMC 1 cut(s) 400
BstV1I GCAGC 1 cut(s) 397
BstX2I RGATCY 3 cut(s) 57, 199, 385
BstYI RGATCY 3 cut(s) 57, 199, 385
BsuRI GGCC 2 cut(s) 226, 425
BtsIMutI CAGTG 3 cut(s) 171, 288, 527
Cac8I GCNNGC 1 cut(s) 85
Csp6I GTAC 1 cut(s) 172
CviAII CATG 1 cut(s) 323
CviQI GTAC 1 cut(s) 172
DdeI CTNAG 4 cut(s) 420, 427, 508, 518
DpnI GATC 3 cut(s) 59, 201, 387
DpnII GATC 3 cut(s) 57, 199, 385
DraI TTTAAA 1 cut(s) 469
Eam1104I CTCTTC 2 cut(s) 34, 336
EarI CTCTTC 2 cut(s) 34, 336
Eco147I AGGCCT 1 cut(s) 425
EcoRII CCWGG 1 cut(s) 391
FaeI CATG 1 cut(s) 326
FaiI YATR 7 cut(s) 103, 196, 229, 263, 270, 324, 482
FatI CATG 1 cut(s) 322
Fnu4HI GCNGC 1 cut(s) 411
Fsp4HI GCNGC 1 cut(s) 411
FspBI CTAG 1 cut(s) 282
GluI GCNGC 1 cut(s) 411
HaeIII GGCC 2 cut(s) 226, 425
Hin1II CATG 1 cut(s) 326
HincII GTYRAC 1 cut(s) 277
HindII GTYRAC 1 cut(s) 277
HinfI GANTC 2 cut(s) 150, 278
Hpy166II GTNNAC 5 cut(s) 15, 132, 209, 277, 398
Hpy188I TCNGA 2 cut(s) 57, 71
Hpy188III TCNNGA 2 cut(s) 16, 537
Hpy8I GTNNAC 5 cut(s) 15, 132, 209, 277, 398
HpyAV CCTTC 1 cut(s) 485
HpyCH4III ACNGT 2 cut(s) 166, 452
HpyCH4V TGCA 5 cut(s) 169, 356, 398, 413, 436
HpyF3I CTNAG 4 cut(s) 420, 427, 508, 518
Hsp92II CATG 1 cut(s) 326
Kzo9I GATC 3 cut(s) 57, 199, 385
LpnPI CCDG 9 cut(s) 69, 208, 280, 284, 368, 378, 405, 499, 522
Lsp1109I GCAGC 1 cut(s) 397
LweI GCATC 2 cut(s) 227, 397
MaeI CTAG 1 cut(s) 282
MaeIII GTNAC 2 cut(s) 284, 521
MalI GATC 3 cut(s) 59, 201, 387
MboI GATC 3 cut(s) 57, 199, 385
MboII GAAGA 3 cut(s) 21, 353, 380
MflI RGATCY 3 cut(s) 57, 199, 385
MhlI GDGCHC 1 cut(s) 400
MluCI AATT 2 cut(s) 135, 185
MlyI GAGTC 1 cut(s) 272
MmeI TCCRAC 1 cut(s) 164
MroXI GAANNNNTTC 1 cut(s) 23
MseI TTAA 1 cut(s) 468
MslI CAYNNNNRTG 1 cut(s) 20
MspR9I CCNGG 1 cut(s) 393
MvaI CCWGG 1 cut(s) 393
NdeII GATC 3 cut(s) 57, 199, 385
NlaIII CATG 1 cut(s) 326
NlaIV GGNNCC 1 cut(s) 59
NmuCI GTSAC 1 cut(s) 284
PceI AGGCCT 1 cut(s) 425
PdmI GAANNNNTTC 1 cut(s) 23
PfeI GAWTC 1 cut(s) 150
PflMI CCANNNNNTGG 1 cut(s) 146
PkrI GCNGC 1 cut(s) 412
PleI GAGTC 1 cut(s) 272
PpsI GAGTC 1 cut(s) 272
Psp6I CCWGG 1 cut(s) 391
PspGI CCWGG 1 cut(s) 391
PspN4I GGNNCC 1 cut(s) 59
PsuI RGATCY 3 cut(s) 57, 199, 385
RsaI GTAC 1 cut(s) 173
RsaNI GTAC 1 cut(s) 172
RseI CAYNNNNRTG 1 cut(s) 20
SaqAI TTAA 1 cut(s) 468
SatI GCNGC 1 cut(s) 411
Sau3AI GATC 3 cut(s) 57, 199, 385
SchI GAGTC 1 cut(s) 272
ScrFI CCNGG 1 cut(s) 393
SduI GDGCHC 1 cut(s) 400
SetI ASST 5 cut(s) 126, 310, 355, 496, 544
SfaNI GCATC 2 cut(s) 227, 397
SfcI CTRYAG 1 cut(s) 110
SmiMI CAYNNNNRTG 1 cut(s) 20
SmlI CTYRAG 1 cut(s) 255
SmoI CTYRAG 1 cut(s) 255
Sse9I AATT 2 cut(s) 135, 185
SseBI AGGCCT 1 cut(s) 425
SspMI CTAG 1 cut(s) 282
StuI AGGCCT 1 cut(s) 425
StyD4I CCNGG 1 cut(s) 391
TaaI ACNGT 2 cut(s) 166, 452
TasI AATT 2 cut(s) 135, 185
TatI WGTACW 1 cut(s) 171
TfiI GAWTC 1 cut(s) 150
Tru1I TTAA 1 cut(s) 468
Tru9I TTAA 1 cut(s) 468
TscAI CASTG 3 cut(s) 171, 295, 534
TseFI GTSAC 1 cut(s) 284
TseI GCWGC 1 cut(s) 410
Tsp45I GTSAC 1 cut(s) 284
TspDTI ATGAA 1 cut(s) 311
TspRI CASTG 3 cut(s) 171, 295, 534
Van91I CCANNNNNTGG 1 cut(s) 146
VneI GTGCAC 1 cut(s) 396
XapI RAATTY 1 cut(s) 185
XmnI GAANNNNTTC 1 cut(s) 23
XspI CTAG 1 cut(s) 282
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.