Prupe.1G203300_v2.0.a1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
OG0008695
Physical Location & Seq
Forward (+)
20243594 .. 20244287
694 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G203300.1

Sequence Viewer

Length: 246 bp
ATGAATTTCCCCAAGATGAGTAGCATATTGATCATCTTTATGATATCCGTGGCCATCTGGGTCGGCAGTGCTCCAGTCGAAGCGAGCAGAGTTTTACAGGAGGACTTTGCTGGTGCAAATCACTTGGAGACATTCTCCTCCTCGTCCTTGTCGTCGTCATCGGTTTACGAGAAGGCCAAGTTTACCATGGAATGCTGGCTTGAACGTTTAGCTTCAGGACCTAGCCCCAAAGGGCCTGGTCACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

82

Amino Acids

8.78

Weight (kDa)

6.04

Isoelectric Point (pI)

67.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclI AACGTT 1 cut(s) 205
AcoI YGGCCR 1 cut(s) 51
AcsI RAATTY 1 cut(s) 4
AcuI CTGAAG 1 cut(s) 198
AgsI TTSAA 1 cut(s) 203
AjnI CCWGG 1 cut(s) 235
AluBI AGCT 1 cut(s) 212
AluI AGCT 1 cut(s) 212
Alw21I GWGCWC 1 cut(s) 73
Alw26I GTCTC 1 cut(s) 122
AoxI GGCC 3 cut(s) 51, 174, 233
ApoI RAATTY 1 cut(s) 4
AspS9I GGNCC 2 cut(s) 218, 233
AvaII GGWCC 1 cut(s) 218
BalI TGGCCA 1 cut(s) 53
Bbv12I GWGCWC 1 cut(s) 73
BccI CCATC 1 cut(s) 62
BciT130I CCWGG 1 cut(s) 237
BclI TGATCA 1 cut(s) 30
BcoDI GTCTC 1 cut(s) 122
BfaI CTAG 2 cut(s) 222, 244
Bme1390I CCNGG 1 cut(s) 237
Bme18I GGWCC 1 cut(s) 218
BmgT120I GGNCC 2 cut(s) 218, 233
BmrFI CCNGG 1 cut(s) 237
BplI GAGNNNNNCTC 2 cut(s) 119, 151
BpmI CTGGAG 1 cut(s) 57
BsaJI CCNNGG 2 cut(s) 48, 186
Bse1I ACTGG 1 cut(s) 74
BseBI CCWGG 1 cut(s) 237
BseDI CCNNGG 2 cut(s) 48, 186
BseNI ACTGG 1 cut(s) 74
BseRI GAGGAG 2 cut(s) 127, 130
BshFI GGCC 3 cut(s) 53, 176, 235
BsiHKAI GWGCWC 1 cut(s) 73
BsmAI GTCTC 1 cut(s) 122
BsmI GAATGC 1 cut(s) 197
BsnI GGCC 3 cut(s) 53, 176, 235
Bsp1286I GDGCHC 1 cut(s) 73
Bsp143I GATC 1 cut(s) 30
Bsp19I CCATGG 1 cut(s) 186
BspANI GGCC 3 cut(s) 53, 176, 235
BsrI ACTGG 1 cut(s) 74
BssECI CCNNGG 2 cut(s) 48, 186
BssMI GATC 1 cut(s) 30
BssT1I CCWWGG 1 cut(s) 186
Bst2UI CCWGG 1 cut(s) 237
BstC8I GCNNGC 2 cut(s) 85, 197
BstDSI CCRYGG 2 cut(s) 48, 186
BstKTI GATC 1 cut(s) 33
BstMAI GTCTC 1 cut(s) 122
BstMBI GATC 1 cut(s) 30
BstNI CCWGG 1 cut(s) 237
BstSCI CCNGG 1 cut(s) 235
BsuRI GGCC 3 cut(s) 53, 176, 235
BtgI CCRYGG 2 cut(s) 48, 186
BtsI GCAGTG 1 cut(s) 73
BtsIMutI CAGTG 1 cut(s) 73
Cac8I GCNNGC 2 cut(s) 85, 197
Cfr13I GGNCC 2 cut(s) 218, 233
CviAII CATG 1 cut(s) 187
CviJI RGCY 6 cut(s) 53, 176, 199, 212, 225, 235
CviKI_1 RGCY 6 cut(s) 53, 176, 199, 212, 225, 235
DpnI GATC 1 cut(s) 32
DpnII GATC 1 cut(s) 30
EaeI YGGCCR 1 cut(s) 51
Eco130I CCWWGG 1 cut(s) 186
Eco32I GATATC 1 cut(s) 45
Eco47I GGWCC 1 cut(s) 218
Eco57I CTGAAG 1 cut(s) 198
EcoO109I RGGNCCY 2 cut(s) 218, 233
EcoRII CCWGG 1 cut(s) 235
EcoRV GATATC 1 cut(s) 45
EcoT14I CCWWGG 1 cut(s) 186
ErhI CCWWGG 1 cut(s) 186
FaeI CATG 1 cut(s) 190
FaiI YATR 3 cut(s) 26, 41, 188
FatI CATG 1 cut(s) 186
FbaI TGATCA 1 cut(s) 30
FspBI CTAG 2 cut(s) 222, 244
GsuI CTGGAG 1 cut(s) 57
HaeIII GGCC 3 cut(s) 53, 176, 235
Hin1II CATG 1 cut(s) 190
Hpy166II GTNNAC 2 cut(s) 166, 183
Hpy188III TCNNGA 1 cut(s) 216
Hpy8I GTNNAC 2 cut(s) 166, 183
Hpy99I CGWCG 1 cut(s) 157
HpyAV CCTTC 1 cut(s) 166
HpyCH4IV ACGT 1 cut(s) 205
HpyCH4V TGCA 1 cut(s) 116
HpySE526I ACGT 1 cut(s) 205
Hsp92II CATG 1 cut(s) 190
Ksp22I TGATCA 1 cut(s) 30
Kzo9I GATC 1 cut(s) 30
LmnI GCTCC 1 cut(s) 76
LpnPI CCDG 7 cut(s) 43, 83, 87, 96, 181, 201, 222
MaeI CTAG 2 cut(s) 222, 244
MaeII ACGT 1 cut(s) 205
MaeIII GTNAC 1 cut(s) 239
MalI GATC 1 cut(s) 32
MboI GATC 1 cut(s) 30
MhlI GDGCHC 1 cut(s) 73
MlsI TGGCCA 1 cut(s) 53
MluCI AATT 1 cut(s) 4
MluNI TGGCCA 1 cut(s) 53
MnlI CCTC 3 cut(s) 94, 148, 151
Mox20I TGGCCA 1 cut(s) 53
MscI TGGCCA 1 cut(s) 53
MslI CAYNNNNRTG 1 cut(s) 38
Msp20I TGGCCA 1 cut(s) 53
MspR9I CCNGG 1 cut(s) 237
Mva1269I GAATGC 1 cut(s) 197
MvaI CCWGG 1 cut(s) 237
NcoI CCATGG 1 cut(s) 186
NdeII GATC 1 cut(s) 30
NlaIII CATG 1 cut(s) 190
NmuCI GTSAC 1 cut(s) 239
PcsI WCGNNNNNNNCGW 1 cut(s) 149
PctI GAATGC 1 cut(s) 197
PpuMI RGGWCCY 1 cut(s) 218
Psp1406I AACGTT 1 cut(s) 205
Psp5II RGGWCCY 1 cut(s) 218
Psp6I CCWGG 1 cut(s) 235
PspGI CCWGG 1 cut(s) 235
PspPI GGNCC 2 cut(s) 218, 233
PspPPI RGGWCCY 1 cut(s) 218
RseI CAYNNNNRTG 1 cut(s) 38
Sau3AI GATC 1 cut(s) 30
Sau96I GGNCC 2 cut(s) 218, 233
ScrFI CCNGG 1 cut(s) 237
SduI GDGCHC 1 cut(s) 73
SetI ASST 3 cut(s) 208, 214, 223
SinI GGWCC 1 cut(s) 218
SmiMI CAYNNNNRTG 1 cut(s) 38
Sse9I AATT 1 cut(s) 4
SspMI CTAG 2 cut(s) 222, 244
StyD4I CCNGG 1 cut(s) 235
StyI CCWWGG 1 cut(s) 186
TaiI ACGT 1 cut(s) 208
TaqI TCGA 1 cut(s) 78
TasI AATT 1 cut(s) 4
TscAI CASTG 1 cut(s) 73
TseFI GTSAC 1 cut(s) 239
Tsp45I GTSAC 1 cut(s) 239
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 37
TspRI CASTG 1 cut(s) 73
VpaK11BI GGWCC 1 cut(s) 218
XapI RAATTY 1 cut(s) 4
XcmI CCANNNNNNNNNTGG 1 cut(s) 184
XspI CTAG 2 cut(s) 222, 244
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.