Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0007014.1

Orthogroup ID

OG0008695

Physical Location & Seq

Genomic Coordinates Reverse (-)

3489 .. 3722

Gene Structure 234 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0007014.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 234 bp

atgaacttccagaaggtgagtagcctcgtcatcgttttggtcataactgtagcaatcttgggtcattctcaggttcaagcaattagactgctgcccgaggactttgccggtgctaaccatttggagacatactcctccccatcatcgctggcctacgagaaggccaaatacaccatggaatgttggcttcaacgactggcttcaggaccaagccccaaaggacctggtcactag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

77

Amino Acids

8.38

Weight (kDa)

7.93

Isoelectric Point (pI)

50.27

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008695)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G28460
prunus_persica	Prupe.1G203300_v2.0.a1 Prupe.1G203400_v2.0.a1
pyrus_communis	pycom04g04230 pycom04g04240
rosa_laevigata	RLG00000008779 RLG00000008780
rosa_multiflora	Rmu_sc0007014.1_g000001
rosa_roxburghii	Rroxscaffold_2G00121640 Rroxscaffold_5G00351020 Rroxscaffold_5G00351030
rosa_rugosa	Rorug02G0237900 Rorug04G0067600
rosa_samantha	Rh2AG297300 Rh2BG306100 Rh2CG284400 Rh2DG321100 Rh4AG137000 Rh4BG134600 Rh4CG145200 Rh4DG132100
rosa_wichuraiana	Rw0G006880 Rw4G011140

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcuI	CTGAAG	1 cut(s)	186
AgsI	TTSAA	2 cut(s)	77, 191
AjnI	CCWGG	1 cut(s)	223
Alw26I	GTCTC	1 cut(s)	119
Ama87I	CYCGRG	1 cut(s)	95
AoxI	GGCC	2 cut(s)	150, 162
ApeKI	GCWGC	1 cut(s)	91
AspS9I	GGNCC	2 cut(s)	206, 221
AsuHPI	GGTGA	1 cut(s)	28
AvaI	CYCGRG	1 cut(s)	95
AvaII	GGWCC	2 cut(s)	206, 221
BarI	GAAGNNNNNNTAC	2 cut(s)	152, 184
BbvI	GCAGC	1 cut(s)	78
BccI	CCATC	1 cut(s)	148
BcgI	CGANNNNNNTGC	2 cut(s)	86, 120
BciT130I	CCWGG	1 cut(s)	225
BcoDI	GTCTC	1 cut(s)	119
BfaI	CTAG	1 cut(s)	232
BfmI	CTRYAG	1 cut(s)	48
BisI	GCNGC	1 cut(s)	92
BlsI	GCNGC	1 cut(s)	93
Bme1390I	CCNGG	1 cut(s)	225
Bme18I	GGWCC	2 cut(s)	206, 221
BmeT110I	CYCGRG	1 cut(s)	95
BmgT120I	GGNCC	2 cut(s)	206, 221
BmrFI	CCNGG	1 cut(s)	225
BplI	GAGNNNNNCTC	2 cut(s)	116, 148
BsaJI	CCNNGG	2 cut(s)	96, 174
Bse118I	RCCGGY	1 cut(s)	107
Bse1I	ACTGG	1 cut(s)	201
BseBI	CCWGG	1 cut(s)	225
BseDI	CCNNGG	2 cut(s)	96, 174
BseMII	CTCAG	1 cut(s)	83
BseNI	ACTGG	1 cut(s)	201
BseRI	GAGGAG	1 cut(s)	124
BseXI	GCAGC	1 cut(s)	78
BshFI	GGCC	2 cut(s)	152, 164
BsiHKCI	CYCGRG	1 cut(s)	95
BsiSI	CCGG	1 cut(s)	108
BsmAI	GTCTC	1 cut(s)	119
BsnI	GGCC	2 cut(s)	152, 164
BsoBI	CYCGRG	1 cut(s)	95
Bsp19I	CCATGG	1 cut(s)	174
BspANI	GGCC	2 cut(s)	152, 164
BspCNI	CTCAG	1 cut(s)	82
BsrFI	RCCGGY	1 cut(s)	107
BsrI	ACTGG	1 cut(s)	201
BssAI	RCCGGY	1 cut(s)	107
BssECI	CCNNGG	2 cut(s)	96, 174
BssT1I	CCWWGG	1 cut(s)	174
Bst2UI	CCWGG	1 cut(s)	225
Bst4CI	ACNGT	1 cut(s)	49
BstC8I	GCNNGC	1 cut(s)	150
BstDEI	CTNAG	1 cut(s)	69
BstDSI	CCRYGG	1 cut(s)	174
BstMAI	GTCTC	1 cut(s)	119
BstNI	CCWGG	1 cut(s)	225
BstSCI	CCNGG	1 cut(s)	223
BstSFI	CTRYAG	1 cut(s)	48
BstV1I	GCAGC	1 cut(s)	78
BsuRI	GGCC	2 cut(s)	152, 164
BtgI	CCRYGG	1 cut(s)	174
BtgZI	GCGATG	1 cut(s)	129
Cac8I	GCNNGC	1 cut(s)	150
Cfr10I	RCCGGY	1 cut(s)	107
Cfr13I	GGNCC	2 cut(s)	206, 221
CsiI	ACCWGGT	1 cut(s)	223
CviAII	CATG	1 cut(s)	175
CviJI	RGCY	6 cut(s)	24, 152, 164, 187, 200, 213
CviKI_1	RGCY	6 cut(s)	24, 152, 164, 187, 200, 213
DdeI	CTNAG	1 cut(s)	69
Eco130I	CCWWGG	1 cut(s)	174
Eco47I	GGWCC	2 cut(s)	206, 221
Eco57I	CTGAAG	1 cut(s)	186
Eco88I	CYCGRG	1 cut(s)	95
EcoO109I	RGGNCCY	1 cut(s)	221
EcoRII	CCWGG	1 cut(s)	223
EcoT14I	CCWWGG	1 cut(s)	174
ErhI	CCWWGG	1 cut(s)	174
FaeI	CATG	1 cut(s)	178
FaiI	YATR	3 cut(s)	44, 130, 176
FatI	CATG	1 cut(s)	174
Fnu4HI	GCNGC	1 cut(s)	92
Fsp4HI	GCNGC	1 cut(s)	92
FspBI	CTAG	1 cut(s)	232
GluI	GCNGC	1 cut(s)	92
HaeIII	GGCC	2 cut(s)	152, 164
HapII	CCGG	1 cut(s)	108
Hin1II	CATG	1 cut(s)	178
HpaII	CCGG	1 cut(s)	108
HphI	GGTGA	1 cut(s)	28
Hpy188III	TCNNGA	2 cut(s)	10, 204
HpyAV	CCTTC	2 cut(s)	7, 154
HpyCH4III	ACNGT	1 cut(s)	49
HpyF3I	CTNAG	1 cut(s)	69
Hsp92II	CATG	1 cut(s)	178
LpnPI	CCDG	7 cut(s)	23, 56, 121, 134, 182, 189, 210
Lsp1109I	GCAGC	1 cut(s)	78
MabI	ACCWGGT	1 cut(s)	223
MaeI	CTAG	1 cut(s)	232
MaeIII	GTNAC	1 cut(s)	227
MluCI	AATT	1 cut(s)	81
MnlI	CCTC	3 cut(s)	35, 91, 145
MspI	CCGG	1 cut(s)	108
MspR9I	CCNGG	1 cut(s)	225
MvaI	CCWGG	1 cut(s)	225
NcoI	CCATGG	1 cut(s)	174
NlaIII	CATG	1 cut(s)	178
NmuCI	GTSAC	1 cut(s)	227
PflFI	GACNNNGTC	1 cut(s)	225
PkrI	GCNGC	1 cut(s)	93
PpuMI	RGGWCCY	1 cut(s)	221
Psp5II	RGGWCCY	1 cut(s)	221
Psp6I	CCWGG	1 cut(s)	223
PspGI	CCWGG	1 cut(s)	223
PspPI	GGNCC	2 cut(s)	206, 221
PspPPI	RGGWCCY	1 cut(s)	221
PsyI	GACNNNGTC	1 cut(s)	225
SatI	GCNGC	1 cut(s)	92
Sau96I	GGNCC	2 cut(s)	206, 221
ScrFI	CCNGG	1 cut(s)	225
SetI	ASST	3 cut(s)	18, 75, 226
SexAI	ACCWGGT	1 cut(s)	223
SfcI	CTRYAG	1 cut(s)	48
SinI	GGWCC	2 cut(s)	206, 221
Sse9I	AATT	1 cut(s)	81
SspMI	CTAG	1 cut(s)	232
StyD4I	CCNGG	1 cut(s)	223
StyI	CCWWGG	1 cut(s)	174
TaaI	ACNGT	1 cut(s)	49
TasI	AATT	1 cut(s)	81
TseFI	GTSAC	1 cut(s)	227
TseI	GCWGC	1 cut(s)	91
Tsp45I	GTSAC	1 cut(s)	227
TspDTI	ATGAA	1 cut(s)	17
Tth111I	GACNNNGTC	1 cut(s)	225
VpaK11BI	GGWCC	2 cut(s)	206, 221
XcmI	CCANNNNNNNNNTGG	1 cut(s)	172
XspI	CTAG	1 cut(s)	232

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.